Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carychium minimum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATATAATTTTTGGTGTGTGGTGTGGTTTAGTTGGGACTGGGTTATCACTTTTAATTCGTTTTGAACTAGGGACCGCTGGAAACTTACTTGATGATCATTTTTACAATGTAATTGTTACGGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCATTAATAATTGGAGGGTTTGGAAATTGAATAATTCCACTTTTAATTGGTGCACCGGATATAAGATTTCCTCGAATAAATAACATAAGTTTCTGATTATTACCACCATCATTTGTACTACTTATTTTTTCTAGAATAGTAGAAGGTGGTGCTGGGACAGGGTGGACAGTTTATCCGCCATTAAGAGGTCCTATTGGACACGCTGGAGCTTCTGTAGATCTTGCGATTTTTTCTCTACATTTAGCTGGGATATCATCTATTTTAGGGGCTATTAATTTTATTACTACTATTTTTAATATACGGGCCCCAGGGATAACTATAGAGCGAGTAAATTTATTTGTTTGGTCGATTTTAGTTACAGTATTTTTACTTCTCCTTTCACTTCCTGTACTTGCTGGTGCTATTACTATACTTTTAACTGATCGAAATTTTAATACTAGGTTTTTTGATCCAGCAGGAGGTGGGGACCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carychium minimum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 327
Specimens with Barcodes: 332
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Carychium minimum

Carychium minimum is a species of very small air-breathing land snail, a terrestrial pulmonate gastropod mollusk in the family Ellobiidae.

Description[edit]

The shell is 1.6-2.2 mm. high x 0.9-1.1 mm. wide.It is wider than the shell of Carychium tridentatum. If the last whorl above the aperture is opened this shows the plica parietalis (a spiral ridge on the parietal region projecting into the interior of the shell) descending in a simple way downwards (see the figure below).

drawing of shells of Carychium minimum

Distribution[edit]

This species occurs in European countries and islands including:


References[edit]

  1. ^ Müller, O. F. 1774: Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non marinorum, succincta historia. Volumen alterum. - pp. I-XXVI [= 1-36], 1-214, [1-10]. Havniæ & Lipsiæ. (Heineck & Faber).
  2. ^ Balashov I. & Gural-Sverlova N. 2012. An annotated checklist of the terrestrial molluscs of Ukraine. Journal of Conchology. 41 (1): 91-109.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!