Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carychium exiguum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAATCATAAAGATATTGGAACATTATATATAATTTTTGGTGTATGATGCGGTTTGGTTGGTACAGGATTATCACTTTTAATTCGTTTTGAATTAGGAACTGCTGGAAACTTACTTGATGATCATTTTTATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTCATAGTTATACCTTTAATAATTGGTGGATTTGGAAATTGAATAATTCCACTTTTAATTGGTGCACCAGACATAAGTTTTCCTCGAATAAATAATATAAGTTTTTGATTACTACCACCATCATTCATTCTACTTATTTTTTCTAGAATAGTAGAAGGTGGTGCTGGAACAGGATGAACAGTTTATCCTCCATTAAGTGGTCCAATTGGGCATGCTGGAGCTTCTGTAGATCTTGCAATTTTTTCTTTACACTTGGCTGGTATGTCATCTATTTTAGGAGCTATTAATTTCATTACTACTATTTTTAACATACGAGCTCCAGGAATAACTATGGAGCGAGTTAATTTATTTGTTTGATCAATTTTAGTTACAGTATTCTTACTTCTTCTTTCTCTTCCTGTACTTGCAGGAGCTATTACAATGCTTTTAACTGATCGAAATTTTAATACTAGATTTTTTGATCCAGCCGGTGGTGGTGATCCCATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carychium exiguum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Carychium exiguum

Carychium exiguum, common name the obese thorn snail, is a species of minute air-breathing land snail, a terrestrial pulmonate gastropod mollusk in the subfamily Carychiinae.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Based on statisticall analyses of shell height and width of Carychium exile and Carychium exiguum from 141 locations across a wide region encompassing the Great Lakes, C. exile and C. exiguum are clearly separated and represent distinct taxa. Further, Scanning Electron Micrographs of individuals from eight populations representing latitudinal variation in shell size (southern Illinois to northern Michigan to southern Ontario) demonstrate that most populations support all three known size classes and the former division of C. exile into distinct subspecies (Carychium exile canadense, Carychium exile exile) does not appear warranted (Nekola and Barthel, 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!