Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Burch (1989) cites Physa acuta as occurring in Europe, Mediterranean regions, and Africa; and widely introduced into Australia, Hawaii, and the continental United States. As Physa cubensis, now considered a synonym, it is widely distributed in the West Indies, Central America, and northern South America, and it occurs throughout Florida and adjacent Alabama and Georgia (Thompson, 1999). As Physa cubensis, considered a synonym, it is widely distributed in the West Indies, Central America, and northern South America, and occurs throughout Florida and adjacent Alabama and Georgia (Thompson, 1999). Burch (1989) lists several synonyms including P. heterostropha heterostropha from Nova Scotia to Ontario; New England to Ohio, Tennessee and the Virginias; and the Bahamas; P. heterostropha halei from Illinois, Missouri, Kansas, Arkansas and Texas; P. integra integra from Quebec to Manitoba, Canada, and the Great Lakes states, Iowa, South Dakota, Tennessee, Kentucky, and West Virginia; P. integra integra morph walkeri from Quebec, Ontario and the Great Lakes states; P. integra brevispira from New York, Ohio, Wisconsin and Minnesota; P. virgata virgata from Nebraska west to California, east to Texas and into Mexico; P. virgata virgata morph parva from Iowa west to California, east to Texas and north to Kansas; P. virgata anatina from Wisconsin and South Dakota southwest to Colorado and Nevada; Texas and Arkansas north to Illinois and Nebraska; P. virgata berendti from Wyoming to California, southeast to Texas and Mexico and north to Kansas; P. virgata concolor from Manitoba and Wisconsin to Idaho; P. virgata rhyssa from California, New Mexico and Texas into Mexico. It is considered globally invasive with introduced populations in Europe, Asia, Australia (Madsen and Frandsen, 1989), Africa (Appleton, 2003), and recently Lake Titicaca in Peru (Albrecht et al., 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Burch (1989) cites P. cubensis cubensis as Bahamas, Cuba, Jamaica, Puerto Rico, the West Indies, Honduras, and Florida; with P. cubensis peninsularis in Florida. Taylor (2003) lists Haitia [= Physa] cubensis from the Bahamas; Cuba; Jamaica; Hispaniola; Puerto Rica; less abundant in Lesser Antilles as far S as Martinique; as H. integra, Great Lakes (Minnesota, Michigan) and South Dakota and North Dakota. In Indiana, Pyron et al. (2008) list it statewide. In Missouri, Wu et al. (1997) list (as P. heterostropha) across the Ozark Region and some Prairie Region near the Mississippi River (Carter, Crawford, Dent, Hickory, Howell, Knox, Laclede, Lincoln, Morgan, Newton, Oregon, Pettis, Pike, Reynolds, Ripley, St. Louis, Ste. Genevieve, Shannon, Stone, Washington, Wright Cos.); and (as P. anatina) widely (Adair, Andrew, Atchison, Audrain, Bates, Boone, Buchanan, Caldwell, Camden, Carroll, Cass, Chariton, Clay, Cooper, Crawford, Daviess, Dent, Dunklin, Franklin, Gasconade, Harrison, Holt, Howard, Howell, Iron, Jefferson, Johnson, Lincoln, Linn, Livingston, Macon, Mississippi, Montgomery, New Madrid, Nodaway, Oregon, Pemiscot, Pettis, Phelps, Pike, Platte, Polk, Pulaski, Putnam, Ralls, Ray, Reynolds, Ripley, St. Charles, St. Francois, St. Louis, Saline, Schuyler, Scott, Shannon, Stoddard, Warren, Washington, Wayne, Worth Cos.) except SW Ozarks; and P. halei statewide (Audrain, Barry, Bates, Bollinger, Boone, Butler, Callaway, Cape Girardeau, Carroll, Carter, Cass, Clay, Cole, Cooper, Crawford, Dade, Dallas, De Kalb, Dent, Dunklin, Gasconade, Greene, Henry, Hickory, Holt, Howard, Iron, Jackson, Jefferson, Knox, Laclede, Lincoln, McDonald, Macon, Madison, Miller, Mississippi, Moniteau, Montgomery, New Madrid, Nodaway, Oregon, Ozark Pemiscot, Perry, Pettis, Pike, Randolph, Ray, Reynolds, Ripley, St. Charles, St. Francois, St. Louis, Ste. Genevieve, Saline, Scott, Shannon, Stoddard, Warren, Washington, Wayne, Webster, Wright Cos.); and (as P. peninsularis) from Holt and St. Louis Cos.; nominal acuta from Butler, Carter, Grundy, Hickory, Holt, Howell, Jackson, Linn, Oregon, and St. Francois Cos. In Alabama (as P. heterostropha) it is statewide and common (Mirarchi, 2004). Blair and Sickel (1986) documented P. integra in 2 of 44 sites and P. heterostropha in 4 of 44 sites in Land Between the Lakes (between Cumberland River (Lake Berkeley) and Tennessee River (Kentucky Lake)), Tennessee. It occurs at the Savannah River Power Plant, Aiken, South Carolina (Wood, 1982). Kentucky: Kentucky, Cumberland, Licking, Green, Salt (also Rosewater, 1959), Ohio drainages (Branson and Batch, 1981; 1983; 1987). Schwartz and Meredith (1962) list P. heterostropha on the Blackwater and Laurel Fork Rivers, West Virginia. Wu and Beetle (1995) list Wyoming (as P. heterostropha) statewide: Albany, Big Horn, Campbell, Carbon, Converse, Fremont, Goshen, Johnson, Laramie, Lincoln, Sheridan, Sublette, Sweetwater, Teton, Uinta Cos. and Yellowstone National Park; as P. integra from plains Cos. Carbon, Fremont, Hot Springs, Laramie, Natrona, and Weston, and (as P. anatina) in Hot Spring Co.. Wu and Liu (2001) list it from Cloud and Nemaha Cos., N of the Kansas River and Clark and Comanche Cos. on the SW Kansas border, Kansas. Wu and Liu (2001) list Kansas records (as P. halei) from Chautauqua, Clark, Coffey, Harvey, Jefferson, adn Phillip Cos.. Branson (1966) cites Spring River drainage, Kansas and Missouri. Wu (2005) documented it in Nebraska (as P. heterostropha) in north central Cherry, Logan, and Rock Cos.; as P. halei in Custer, Dundy, and Garden Cos.; and nominally scattered near the Mississippi and large rivers in the E in Dakota, Gage, Greeley, Keith, Nemaha, Pawnee Cos. Pearce and Evans (2008) cite Plummers Island (Middle Potomac), Maryland. In Pennsylvania, it is statewide and common (Evans and Ray, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Physa acuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 25 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAGGTTTAAGCTTGTTAATTCGTTTGGAATTAGGAACATCACTTGTACTGTTGGATGAA------CATTTTTATAATGTAATTGTTACACCACATGCGCTTGTAATGATTGTTTTTATAGTTATACCAATAATAATTGGAGGGTTTGGGAATTGAATAGTACCTATATTAATTGGTGCTCCTGATATAAGATTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCACCTTCATTTATCTTATTATTATGTAGGTCTATAGTTGAGGGTGGAGTTGGAACTGGATGAACTGTTTATCCTCCTCTATCAGGACCTGTAGCTCACTCTGGTTCATCAGTAGATCTTGCTATTTTCTCATTACACTTAGCTGGGTTATCATCTATTCTAGGTGCTATTAATTTTATTACTACGATTTTTAATATACGTTCTCCTGGTATTACACTGGAACGAATAAGCTTATTTGTTTGATCAGTGTTAATTACTGCATTTTTATTATTATTGTCATTGCCTGTTTTAGCAGGGGCTATTACTATACTATTAACTGATCGAAATTTTAATACTAGGTTCTTTGATCCAAGAGGGGGGGGAGACCCTATTCTATATCAACATCTATTTTGATTTTTTGGTCATCCAGAAGTGTATATTTTAATTTTGCCTGGATTTGGAATCATCAGACATATTTTATCTAACTTTACT---AATAAACCTGCATTTGGTACCTTAGGAATAATTTATGCTATGTTAAGTATTGGTGTCTTAGGTTTCATTGTGTGGGCACACCATATGTTTACGGTAGGTATAGATGTTGACACACGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Physa acuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is likely a European native that has been widely introduced around the world and is both common and abundant. This species has a wide distribution, presumed large population, occurrence in a number of protected areas, tolerance of a broad range of habitats, tolerance to habitat modification, lack of substantial immediate threats, and because it is not in decline or is unlikely to be declining fast enough to qualify for listing in a more threatened category.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: In a study of physid distribution across habitat gradient as a response to predators, this species was found to be most successful in ponds of intermediate depth (but generally successful under all conditions) and high predator abundance (Turner and Montgomery, 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Global Long Term Trend: Increase of >25%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Physella acuta

Physella acuta is a species of small, left-handed or sinistral, air-breathing freshwater snail, an aquatic gastropod mollusk in the family Physidae. Alternate names include Physa acuta, European physa, Tadpole Snail, Bladder Snail, and Acute Bladder Snail. In addition, Physa heterostropha (Say, 1817) and Physa integra (Haldeman, 1841) are synonyms of Physella acuta (Draparnaud, 1805).

Shell description[edit]

Shell of Physella acuta.

Snails in the family Physidae have shells that are sinistral, which means that if the shell is held with the aperture facing the observer and the spire pointing up, then the aperture is on the left-hand side.

The shells of Physella species have a long and large aperture, a pointed spire, and no operculum. The shells are thin and corneous and rather transparent.

Distribution[edit]

It was once thought that the indigenous distribution of Physella acuta is Mediterranean.[4][5] However, when Physella heterostropha is considered to be a synonym, then the indigenous distribution of the species is North-American.[6]

Physella acuta is a common species which is common in all of North America and Europe. The species seems to have first spread through the Mediterranean regions and then more slowly into Northern Europe.[3][6]

In Europe[edit]

This species is found in:

The distribution also includes Mediterranean regions and Africa.[10]

In America[edit]

The distribution includes the United States: Maryland, New Jersey, and Virginia.[10]

Ecology[edit]

Habitat[edit]

This species lives in freshwater rivers, streams, lakes, ponds, and swamps.[10]

Physella acuta is frequently found in anthropogenic reservoirs, occurring in warm water discharges from power stations and in some rivers, but very rarely and not numerously in clay pit ponds. It can survive well under temporary harsh conditions (extreme temperature and water pollution), as long as they are short-lived.[6]

Feeding habits[edit]

These snails eat dead plant and animal matter and various other detritus.

While Physella acuta forages mainly on epiphytic vegetation and on the macrophytes, other gastropods (Planorbis planorbis, Radix ovata) exploit the algal cover or phytobentos on the bottom. Therefore competition between Physella acuta and other gastropods appears to be minimal.[6]

Interspecific relationship[edit]

This species successfully co-exists with other alien gastropods: for example with Potamopyrgus antipodarum in many streams, lakes and ponds in New Zealand and with Lithoglyphus naticoides in the Danube River.[6]

References[edit]

This article incorporates CC-BY-2.0 text (but not under GFDL) from reference.[6]

  1. ^ 2006 IUCN Red List of Threatened Species. <www.iucnredlist.org>. Cited 30 April 2007.
  2. ^ Draparnaud J.-P.-R. 1805. Histoire naturelle des mollusques terrestres et fluviatiles de la France. Ouvrage posthume. Avec XIII planches. pp. [1-9], j-viij [= 1-8], 1-134, [Plates 1-13]. Paris, Montpellier. (Plassan, Renaud).
  3. ^ a b c Dillon R. T., Wethington A. R., Rhett J. M. & Smith T. P. 2002. Populations of the European freshwater pulmonate Physa acuta are not reproductively isolated from American Physa heterostopha or Physa integra. Invertebrate Biology, 121: 226-234. (abstract)
  4. ^ (Slovak) Lisický M. J. (1991). Mollusca Slovenska [The Slovak molluscs]. VEDA vydavateľstvo Slovenskej akadémie vied, Bratislava, 344 pp.
  5. ^ Glöer, P. 2002 Die Süßwassergastropoden Nord- und Mitteleuropas. Die Tierwelt Deutschlands, ConchBooks, Hackenheim, 326 pp., ISBN 3-925919-60-0, page 238-239.
  6. ^ a b c d e f g Vitaliy Semenchenko, Tatiana Laenko & Vladimir Razlutskij. 2008. A new record of the North American gastropod Physella acuta (Draparnaud 1805) from the Neman River Basin, Belarus. Aquatic Invasions (2008) Volume 3, Issue 3: 359-360.
  7. ^ Beran, L. (2002) Vodní měkkýši České Republiky - rozšíření a jeho změny, stanoviště, šíření, ohrožení a ochrana, červený seznam. Aquatic moluscs of the Czech Republic - distribution and its changes, habitats, dispersal, threat and protection, Red List. - Sborník přírodovědného klubu v Uherském Hradišti, Supplementum 10, 258 pp. (in Czech)
  8. ^ MollBase - Physella acuta - Spitze Blasenschnecke - Atlas 1991
  9. ^ "Physella acuta". 2005. 
  10. ^ a b c Amy Benson. 2007. Physella acuta. USGS Nonindigenous Aquatic Species Database, Gainesville, FL. http://nas.er.usgs.gov/queries/FactSheet.asp?speciesID=1025 Revision Date: 4/22/2004
  11. ^ Vázquez A. A. & Perera S. (2010). "Endemic Freshwater molluscs of Cuba and their conservation status". Tropical Conservation Science 3(2): 190-199. HTM, PDF.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The entire family Physidae is in need of revision. Preliminary work suggests that type specimens do not match figures in original descriptions or subsequent guides. At the present time it is difficult to assess the taxonomic status of most of these species. Most species appear to display a wide range of variability in shell morphology (Gordon pers. comm. 1993). There is some question as to whether this species is a North American native introduced to Europe or vice versa. Dillon et al. (2002) found no evidence of reproductive isolation between Physella acuta and the American Physella heterostropha and Physa integra indicating P. acuta is native to North America and introduced elsewhere making P. heterostropha and P. integra junior synonyms. This is supported by Anderson (2003) who also synonymizes P. heterostropha with P. acuta. Taylor (2003) lists this species as Haitia integra. Taylor (2003) also describes a new species that is potentially extinct, Physella hemphilli, based upon specimens from Coeur D'Alene Lake in Idaho, but this may be a synonym or variety of Physa heterostropha which Wethington and Lydeard (2007) synonymize with Physa acuta. A study of molecular phylogeny of the family Physidae conducted by Wethington and Lydeard (2007) resulted in proposed monophyly of the family and supported six major clades, each with a corresponding difference in penial morphology; with Physa acuta falling within the type c group. Further, Wethington and Lydeard (2007) concluded that P. acuta, P. heterostropha, P. integra, P. virgata, P. cubensis and P. integra niagarensis to constitute an exclusive clade, and all are attributed to one phylogenetic species, to which the valid name P. acuta applies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!