Overview

Distribution

Range Description

This species has been described in Europe, extending north to Scandinavia and east into Western Siberia (Taylor 2003, Kantor et al. 2009). It has also been recorded from the Canary Islands (Taylor 2003) and Turkey (Yildirim 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is opportunisitic and can be found in (moderately) polluted waterbodies (Appleton and Brackenbury 1998, Whitehead 2008), inhabiting springs, streams, rivers, ponds, lakes as well as canals and irrigation ditches (Taylor 2003). It occurs in nutrient-poor and richly vegetated habitats (Vermonden et al. 2009).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / rests in
Chaetogaster limnaei rests inside shell of Physa fontinalis
Other: minor host/prey

Animal / parasite / endoparasite
furcocercaria of Cotylurus cornutus endoparasitises Physa fontinalis
Remarks: Other: uncertain

Animal / rests in
metacercarial cyst of Echinoparyphium recurvatum rests inside digestive gland of Physa fontinalis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Physa fontinalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTGTATTTAATTTTTGGGGTTTGATGTGGATTGGTTGGAACTGGATTAAGCTTGTTAATTCGTTTAGAGTTAGGTACAACATTAGTATTATTAGATGAA------CATTTTTATAATGTTATTGTAACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATAATAATTGGTGGGTTTGGTAACTGAATGGTACCTATATTAATTGGAGCTCCTGATATAAGATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCTTCTTTTATTTTATTATTATGTTCTTCTATAGTTGAAGGAGGAGTAGGGACTGGTTGAACAGTTTACCCACCATTATCTGGTCCTATTGCTCATTCTGGATCATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGGTTATCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTTTTAACATACGATCTCCTGGTATTACACTAGAGCGTATAAGCTTATTTGTTTGATCAGTTCTTATTACTGCATTTTTGTTATTATTATCCTTACCAGTTCTAGCTGGAGCTATTACTATGTTACTAACAGATCGCAATTTTAATACTAGGTTTTTTGACCCAACCGGAGGTGGAGACCCAATCTCATATAAACATTTGTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Physa fontinalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Van Damme, D.

Reviewer/s
Böhm, M. & Collen, B.

Contributor/s

Justification
Physa fontinalis has been assessed as Least Concern. Despite being recorded on national and regional Red Lists, this species is widely distributed and abundant throughout the Palearctic region, and there are currently no major threats to the status of the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is widespread throughout Europe and Russia, and has been described as being common with a fairly continuous distribution (Leung et al. 2004, D.van Damme pers. comm. 2011).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Although this species demonstrates a moderate tolerance to pollution, the impacts of water pollution from a variety of sources are the main threat to the global population of this species (D.van Damme pers. comm. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place and none considered necessary given the range of this holarctic species, however it is considered to be locally threatened. This species is listed as Near Threatened on the Red List of the Czech Republic (Beran et al. 2005), and as 'highly endangered' on the Swiss national Red List (Turner et al. 1994 cited in Byrne et al. 2009). It is also listed as 'R' (Rare) on the regional Red List for the Alsace region (France) (ODONAT 2003 cited in Byrne et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Physa fontinalis

Physa fontinalis, common name the common bladder snail, is a species of air-breathing freshwater snail, an aquatic gastropod mollusk in the family Physidae. The shells of species in the genus Physa are left-handed or sinistral.

Description[edit]

The shell is 7 to 12 mm high and 4 to 7 mm wide. The spiral has four to five whorls ( the last of which forms more than three-quarters of the shell height) and the apex is rounded. The shell is very thin-walled, translucent, shiny and is a pale horn colour.The aperture is wide and oval, and the mouth edge is very thin and brittle. The body color is brown to black. The edges of the mantle extend as finger-like lobes over the exterior of the shell.The tentacles are long, slender and cylindrical, with the eyes at the base. The foot is long and thin. Bladder snails are hermaphrodites.

Ecology[edit]

This species is an opportunist inhabiting streams, rivers, ponds, lakes, springs, canals and irrigation ditches.It occurs in both nutrient-poor and richly vegetated habitats.It may be found in (moderately) polluted waterbodies.

Distribution[edit]

This species is found in the Czech Republic, Germany, Poland, the Netherlands, Slovakia, Croatia[2] and others.

Threats[edit]

Physa fontinalis is a Least Concern species.[3] but is included on National and Regional Red Lists.

References[edit]

  1. ^ Linnaeus C. (1758). Systema Naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. 10th edition. - Vermes. Testacea: 700-781. Holmiae. (Salvius).
  2. ^ Beran L. (2009). "The first record of Anisus vorticulus (Troschel, 1834) (Gastropoda: Planorbidae) in Croatia?". Malacologica Bohemoslovaca 8: 70. PDF.
  3. ^ IUCN Red list
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!