Overview

Distribution

Range Description

There is some confusion about the range of this species following recent molecular investigations. Bank et al. (2002) reported the species as restricted to the Canary Islands, however according to Albrecht et al. (2007) and Pfenninger et al. (2003), the species found in the Canary Islands, has a range extending through the Mediterranean. Fauna Europea (Bank et al. 2006) now has the range including the Azores and Canary Islands, but not the Madeiran islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widespread throughout Europe and is also present in north and north-eastern Africa (Geldiay 1956, Durrant 1977, Pfenninger et al. 2003), Saudi Arabia (Brown and Wright 1980, Neubert 1998) and Yemen (Al-Safadi 1990). It is also known from Caucasus, Armenia, but is not known from the Afrotropical region (Dirk Van Damme pers. comm. 2011).

Ancylus fluviatilis (sensu stricto) Albrecht et al. (2007): mainly in Northern Europe, but reaching southern limits in Spain, France, Northern Italy and Slovenia. This species is considered Least Concern in Europe. Most of the remaining habitats in the Mediterranean could fall into the species listed below, however the Mediterranean zone is on the southern limit of the distribution of Ancylus fluviatilis (sensu stricto) in the region, and might be affected by decline episodes as a result of the effect of climate change and overexploitation of the main rivers.

Ancylus sp A Albrecht et al. (2007): this is restricted to small area in southern Portugal. The current range of this population is uncertain, and although it may qualify as threatened, given the current status of distributional knowledge, a status of Data Deficient (DD) would be appropriate.

Ancylus sp B Albrecht et al. (2007): mainly found in the Mediterranean region, from the Canary Islands, Morocco, Italy, through to Greece and Turkey. This population, if considered a valid species, would probably qualify as Least Concern (LC) given the extensive range in the Mediterranean, however most of the habitats in the Mediterranean are under pressure for exploitation of water sources, and hence the species may be locally threatened.

Ancylus sp C Albrecht et al. (2007): mainly found in the western Mediterranean region, from Portugal and Spain to Italy. This population, if considered a valid species, would probably qualify as Least Concern (LC) given the extensive range in the Mediterranean, however most of the habitats in Mediterranean are under pressure for exploitation of water sources, and hence the species may be locally threatened

These species should be monitored as their status is currently uncertain and some sub-populations/species maybe threatened as a result of the effect of changing rainfall patterns and over-exploitation of water resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The general habitats for these small freshwater limpets include rivers, streams and other fast-flowing water such as ditches, waterfalls and small outlets from freshwater springs. It is usually found on rocks or submerged wood, and occasionally submerged grasses in the spray-zone of waterfalls (Kerney 1999, Seddon pers. comm. 2010).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is rheophilic, preferring to live in fast flowing rivers generally on a rock substrate (Durrant 1977). This species is found in cold running waters on hard surfaces, with a high amount of dissolved oxygen, and is also found in some lake littorals with high wave energy (D.V. Damme pers. comm. 2011). This species is intolerant to changes in water chemistry and temperature.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Ancylus fluviatilis preys on:
algae

Based on studies in:
UK: Yorkshire, Aire, Nidd & Wharfe Rivers (River)

This list may not be complete but is based on published studies.
  • E. Percival and H. Whitehead, 1929. A quantitative study of the fauna of some types of stream-bed. J. Ecol. 17:282-314, from p. 311 & overleaf.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ancylus fluviatilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACAGGTCTATCATTACTAATCCGTTTTGAATTAGGTTCTAAT---TCAGTAATTATAGAT---GAACATTTTTATAATGTTATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATAATGATTGGTGGATTTGGAAATTGAATAGTACCTTTATTAATTGGTGCTCCTGATATAAGATTTCCACGAATAAATAATATATCATTTTGATTATTACCTCCGTCATTTATTTTATTATTAGTATCTAGAATAGTTGAAGGAGGAGCAGGTACAGGATGAACTGTATATCCTCCTTTAAGAGGATCTATTGCTCATAGTGGTGCTTCTGTTGATTTAGCAATTTTTTCGTTACATTTAGCTGGGATATCATCTATTTTAGGTGCAATTAATTTTATTACAACGATTTTTAATATACGTGCTCCTGGAATTACTATGGAACGTCTTTCCTTATTTGTTTGATCAATTTTAATTACAGCGTTTTTATTATTATTATCGTTACCAGTATTAGCAGGTGCTATTACAATATTACTTACTGACCGAAATTTTAATACTAGATTTTTTGATCCAGCTGGAGGAGGGGATCCTATTTTATATCAACATTTATTTTGGTTTTTTGGTCATCCTGAGGTATATATTTTAATTTTACCAGGATTTGGGATAATTTCTCATATTTTAAGTAATTATGTT---ATAAAACCTGTATTTGGTACTTTAGGAATAATTTATGCTATAGTATCTATTGGAATTTTAGGATTTATTGTATGAGCACATCATATATTTACAGTTGGAATAGATGTAGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ancylus fluviatilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Albrecht, C. & Seddon, M.B.

Reviewer/s
Van Damme, D., von Proschwitz, T., Richman, N. & Nichols, C.

Contributor/s

Justification
This species has been assessed as Data Deficient (DD) based on grounds of taxonomic uncertainty and lack of distributional clarification, following recent research which showed that populations of the river limpets Ancylus fluviatilis are more than one variable species. If the species has an extensive range outside the Canary Islands and the Azores then it should merit Least Concern (LC), but given the taxonomic uncertainty, it is listed as Data Deficient (DD).

This species has also been assessed at regional levels as Data Deficient (DD) at the European level, Date Deficient (DD) at the level of the 27 member states of the European Union, and Data Deficient (DD) at the Mediterranean level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Seddon, M., Albrecht, C. & Van Damme, D.

Reviewer/s
Bohm, M., Collen, B. & García, N.

Contributor/s
Neubert, E. & Amr, Z.S.S.

Justification
Ancylus fluviatilis has been assessed as Least Concern (LC) due to its widespread distribution throughout Europe and northern Africa. There are no current threats to European populations and there is no evidence of declines in African populations despite threats of pollution and habitat degradation.

An increased knowledge of taxonomy and population trends may provide evidence to elevate the species to a higher category, as there are potentially more than 4 taxon currently placed within the species as currently recognised, according to two recent molecular studies. Hence when the results of these studies have been evaluated for their taxonomic implications there maybe additional more range restricted species, however, the main species present over most of Europe would continue to be considered as Least Concern (LC).

History
  • 2011
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The status of this species is uncertain, and as such the general information on subpopulation status is uncertain.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species has been documented as occurring in small, localized populations but there are no specific population trend data available. Durrant (1980) recorded 15-30 individuals per m2 in the River Lea. This species is abundant in unpolluted waters, but absent in others (D.V. Damme pers. comm. 2011).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The threats to this species are uncertain, given that the range is uncertain, however as the species tends to prefer clean fast-flowing water, then general threats will include changes to flow regimes, sedimentation and changes to the river bed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Populations in central Europe and in Africa are threatened by water pollution. African populations are also impacted negatively by habitat degradation and sedimentation as a result of deforestation. Its sensitive tolerance levels make it particularly vulnerable to the future threats of pollution and climate change (Durrant 1977, Geldiay 1956).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known conservation actions for this species, but the species is in need of taxonomic review to determine whether this species is present in the southern Mediterranean or restricted to the Canary islands and the Azores.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions

There are no known conservation measures in place for this species. Further work on taxonomy and population trends is required and management strategies for pollution and deforestation may be necessary.



.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ancylus fluviatilis

Ancylus fluviatilis is a species of very small, freshwater, air-breathing limpet, an aquatic pulmonate gastropod mollusk in the tribe Ancylini within the family Planorbidae, the ram's horn snails and their allies.

Different views of the shell of Ancylus fluviatilis

Description[edit]

The 5-8 mm.limpet-like shell has a backwardly directed, conical apex. The shell shape is higher than Acroloxus and Ferrissia.The apex is blunt when seen from above,but appears more pointed from the side. The shell is bent backwards and very weakly to the right side. It is thin and translucent, with reticulate sculpture and fine growth lines.In colour it is light yellowish to reddish brown or dull pale brown. The animal is grey with black dots near the head and almost entirely covered by the shell. The tentacles are triangular with eyes at their base. The genital pore and pneumostome are very small and located at the right side.

Distribution[edit]

This species occurs in Europe in the following countries and islands:

Habitat[edit]

This freshwater limpet is rheophile, which lives in fast-running waters.

References[edit]

  1. ^ Seddon, M., Albrecht, C. & Van Damme, D. (2012). "Ancylus fluviatilis". IUCN Red List of Threatened Species. Version 2014.1. International Union for Conservation of Nature. Retrieved 29 June 2014. 
  2. ^ Müller O. F. 1774. Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non marinorum, succincta historia. Volumen alterum. pp. I-XXVI [= 1-36], 1-214, [1-10]. Havniae & Lipsiae. (Heineck & Faber).

Further reading[edit]

  • Streit B. (1981). "Food searching and exploitation by a primary consumer (Ancylus fluviatilis) in a stochastic environment: Nonrandom movement pattern". Revue Suisse Zoologie 88: 887-895.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!