Overview

Distribution

Native to the Holarctic (most of the northern hemisphere).

Today introduced worldwide except Antarctica, also on tropical islands such as New Guinea or on Pacific islands (Wiktor 2000).

Type Locality: Frideriksdal near Copenhagen, Denmark (Wiktor 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© www.animalbase.org (F. Welter Schultes); Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is cosmopolitian in distribution and generally assumed to be native to the Palearctic region, but has been introduced by humans to most suitable areas worldwide (Barker, 1999) with the exception of Antarctica.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

External: Light to dark brown, often with some small dark flecks; thin, translucent skin; mantle large, about half of body length and lighter in color; clear mucus on body and sole; slightly paler around pneumostome; short keel; sole light brown; mucus clear and watery (Quick 1960; Kerney & Cameron 1979; Wiktor 2000; Wiktor et al. 2000).

Internal: Dark ovotestis; often aphallic or otherwise with reduced penis (i.e. functionally female); if present, penis long and twisted; stimulator small, cone-shaped but looks more like a papilla; without proper penial gland but with two or more tiny glandular papillae at its end; vas deferens at 2/3 along penis's length and penial retractor at 1/2 length; two pilasters in penial flagellum; retractor unforked and attached at half penis length; tubular oviduct and atrium are unusually long; no rectal caecum (Quick 1960; Kerney & Cameron 1979; Wiktor et al. 2000).

Similar in appearance to D. sturanyi and D. caruanae (Kerney & Cameron 1979). Differs from D. reticulatum: its neck protrudes further from mantle; differs from other Deroceras species: has a "more sinuous penis" with a cylindrical appendix and is frequently aphallic (Quick 1960).

Eggs: 1.8 x 1.5 to 2 x 1.3 mm; translucent, with calcareous particles (Quick 1960).

Juveniles: 4 mm long, white, translucent at hatching with pink-brown tentacles (Quick 1960).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan; www.animalbase.org (F. Welter Schultes)

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Müller (1774) original descriptions on Limax laevis – “Limax niger, glabriuſculus. Corpus totum nigrum, nitidum, absque rugulis nudo oculo in clypeo aut abdomine conſpicuis; nec ſtriæ ullæ margine abdominis ſupra aut ſubtus. Planum inferius utrinque nigrum absque ſtriis transverſis, area media longitudinali ſola pallida. Ope lentis in clypeo ſtriæ transverſæ undulatæ, non interruptæ; in dorſo abdominis rudimenta rugularu conſpiciuntur.”

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© see citation for reference

Source: Malaysian Terrestrial Molluscs

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Limax laevis – “Long. 5 lin, lat. 1 lin.” (Müller, 1774)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© see citation for reference

Source: Malaysian Terrestrial Molluscs

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Up to 22 mm long and slightly larger, but mature specimens can be much smaller (Wiktor 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Comments: This species can be found in many terrestrial habitats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

High ecological tolerance, but needs permanently wet habitats. Usually in lowlands and very humid habitats, swamps, riversides, wetlands, especially alder and oak woods, marshlands and degraded areas, also greenhouses, often near water under wood or detritus. Tolerates subpolar and tropical temperatures. Newly created habitats are often colonized after a few years. In Switzerland in up to 1800 m altitude, but usually below 1000 m, in Bulgaria in up to 2500 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© www.animalbase.org (F. Welter Schultes)

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds on live and dead plants, with some carrion and live invertebrates (Herbert 2010). A fairly wide range of plants is consumed (Getz 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasitoid / endoparasitoid
larva of Tetanocera elata is endoparasitoid of Deroceras laeve

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species was first recorded in Hawaii in 1897 (Cowie, 1997) but has probably become established on all main Hawaiian Islands, inclduing Lanai, Kauai, Oahu, and Maui. Recently it was found in a survey of the Hakalau region, dry gulch near University of Hawaii Hakalau Forest Biological Field Station, Hakalua Forest National Wildlife Refuge, on the windward slopes of Mauna Kea, elevation 6335-6410 feet, Hawaii, Hawaiian Islands (Howarth et al., 2003). Roth and Lindberg (1981) documented it on Attu (Aleutian Islands), Alaska. In California it is known from 14 counties: Alameda, Lake, Los Angeles (including Santa Catalina Island), Marin, Nevada, Placer, Shasta, San Bernardino, San Diego, San Francisco, San Mateo, Santa Barbara (including Santa Cruz Island), Santa Cruz (Roth and Sadeghian, 2006), and Humboldt (McDonnell et al., 2009). It had been documented historically in Colorado (Cockerell, 1927) as Agriolimax campestris. Multiple species of Deroceras spp. were recorded in eastern Maine (11 of 101 sites) from litter samples in a variety of habitats (Nekola, 2008). In New York, Hotopp and Pearce (2007) report it from four counties that are widespread, though it is likely poorly represented. It has been documented recently in southeastern Wisconsin (Jass, 2006). This species is also known from Pleistocene deposits in the Black Hills of Fall River/Custer Cos., South Dakota (Jass et al., 2002). Freeman and Perkins (1992) documented it in Nebraska along the entire Platte River valley. Branson (1966) includes a single site on the Spring River in Missouri. Baxter (1987) cites occurrences in Alaska across much of the state. In Alberta, it is distributed south west of Calgary, north to Lake Louise and Jasper, east to Edmonton and north to Slave Lake (Lepitzki, 2001). It was recently documented in 2 of 82 soil samples and 6 area spot searches of Wind Cave National Park, South Dakota, in 2002 (Anderson, 2005). Pearce (1994) reported it from Mackinac Island, Michigan. Forsyth (2005) documented it in the Upper Fraser Basin of central British Columbia along the shorelines of waterways and permanently wet forested sites; as well as in the Peace-River- northern Rockies region in a small pond west of Ed Bird Lake in the Finlay River valley and in spruce and mixedwood forests such as those on the Liard Plain (Forsyth, 2005). Most recently, it was discovered in the Ktunaxa Traditional Territory in southeastern British Columbia (which extends from near Canada - U.S. border north to about 50 km north of Cranbrook) (Ovaska and Sopuck, 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Ecology

Spring run-off probably serves to disperse D. laeve, which inhabits marshy places (Rollo & Shibata 1991).

Sciomyzid flies Tetanocera plebeia, T. valida prey on D. laeve (Foote 1963, in Stephenson & Knutson 1966). D. laeve is also susceptible to infection from the nematode Phasmarhabditis hermaphrodita (Grewal et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

A fast, active crawler (Quick 1960). D. laeve can be aggressive, wounding other slugs when in high-density populations (Rollo & Wellington 1979).

Not very responsive to moisture levels. Has a wide temperature tolerance, including survival of freezing (Getz 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Life cycle extremely short, down to less than a month, up to 5 generations in a year; several generations can live at the same time. Frequently there are forms with reduced penis, which reproduce by self-fertilisation. Maximum age not more than 1 year.

Can reproduce throughout the year if conditions are good (Jordaens et al. 2006). In Ontario, active April-Nov. with all life stages overwintering (Rollo & Shibata 1991); in Michigan, adults are present in spring and summer, lay eggs immediately after emergence and through the fall (Getz 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© www.animalbase.org (F. Welter Schultes); Paustian, Megan

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Physiology

D. laeve may be able to tolerate freezing, and is active from 0-30 C (Rollo & Shibata 1991). Possible adaptations allowing it to withstand freezing are "ice nucleating agents" that control the formation of ice in its body (Cook 2004) and the production of lots of glucose (a possible cryoprotectant) with exposure to freezing (Storey et al. 2007).

D. laeve is the only land snail that goes deliberately into the water and can survive for days submerged. Can be dispersed by water currents. Eggs also survive submerged; juveniles can hatch under water and then get to the surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Paustian, Megan; www.animalbase.org (F. Welter Schultes)

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Deroceras laeve

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATATAATTTTGGGGGTATGATGTGGAATAGTTGGTACTGGGCTTTCACTATTAATTCGATTAGAATTAGGAACAGCTGGAGTATTATTAGATGAT------CATTTTTTTAATGTTGTAGTAACAGCACATGCATTTGTTATAATTTTTTTTATAGTGATACCAATTATAATTGGGGGATTTGGTAACTGGATGGTACCTTTGCTAATTGGTGCTCCGGACATAAGATTTCCTCGTATAAATAATATAAGTTTTTGGTTATTACCTCCTTCATTTTTATTATTAATTTGTTCTAGAATAGTGGAGGGTGGAGCAGGAACTGGGTGAACAGTTTATCCTCCACTTAGTGGTCCATTAGGGCATGCAGGAGCATCTGTTGATTTAGCAATTTTTTCTCTTCATTTGGCTGGTATATCCTCTATTTTAGGTGCTATTAATTTTATTACTACAATTTTTAATATACGCTCACCTGGTTTGAGTATAGAACGTGTTAGTTTATTTGTTTGATCTATTCTTGTTACTGTTTTTTTATTACTATTATCATTACCAGTATTAGCTGGGGCAATTACTATATTATTAACTGATCGTAATTTTAATACTAGATTTTTTGATCCCACTGGAGGGGGAGATCCTATTTTATACCAGCATCTTTTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Deroceras laeve

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species has a cosmopolitan global distribution and has been introduced widely worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: It was recently documented in 2 of 82 soil samples and 6 area spot searches of Wind Cave National Park, South Dakota, in 2002 (Anderson, 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Risk Statement

Deroceras laeve can be a serious pest in greenhouses. On the other hand, the species is threatened by continuous destructions of wet habitats by drainage, construction projects and road construction. The species has shown little evidence for significant decline in Britain. Lower concern in Switzerland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© www.animalbase.org (F. Welter Schultes)

Source: Terrestrial Slugs Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Deroceras laeve

Deroceras laeve, the marsh slug, is a species of small air-breathing land slug, a terrestrial pulmonate gastropod mollusk in the family Agriolimacidae.

Contents

Distribution

The distribution of Deroceras laeve was originally Palearctic, from the subpolar zones to the southern margins.[4] Today this slug species has been introduced worldwide except Antarctica, also on tropical islands such as New Guinea and on Pacific islands.[4]

Europe:

Asia:

The Americas:

Description

The slug is from brown to dark brown, usually with dark and characteristic but not well visible spots arranged in groups.[4] The shape is almost cylindrical, posterior end is abruptly widened.[4] The mantle covers 50% of body length (unusually large).[4] There are wrinkles on skin present (may disappear in preserved slugs).[4] Mucus is thin, colourless.[4]

This slug is 15–25 mm long when preserved.[4]

The populations of this species that occur in Central Europe are much darker than other Deroceras species in that area.[citation needed]

Drawing of the reproductive system of Deroceras laeve
a - atrium
v - vagina
p - penis
mr - musculus retractor penis
bc - bursa copulatrix.

Reproductive system: Penis is often reduced, elongated if present, without proper penial gland but with two or more tiny glandular papillae and its end.[4] Retractor is unforked and attached at half penis length, stimulator small, cone-shaped but looks more like a papilla.[4] Tubular oviductus and atrium are unusually long.[4] There is no rectal caecum.[4]

Ecology

Habitat

Deroceras laeve has high ecological tolerance, but needs permanently wet habitats.[4] It is usually found in lowlands and very humid habitats, swamps, riversides, wetlands, especially alder and oak woods, marshlands and degraded areas, also greenhouses, often near water under wood or detritus.[4] It tolerates subpolar and tropical temperatures.[4] Newly created habitats are often colonized after a few years.[4] In Switzerland in up to 1800 m altitude, but usually below 1000 m, in Bulgaria in up to 2500 m.[4]

Deroceras laeve can be a serious pest in greenhouses.[4] On the other hand the species is threatened by continuous elimination of wet habitats by drainage, construction projects and road construction.[4]

It is the only land gastropod that goes deliberately into the water and can survive for days submerged.[4] Because of this unusual behavior, the species can be dispersed by flowing water.[4]

Feeding habits

These slugs are agile and crawl quickly. They are omnivorous, but live and dead plant remains are preferred.[4]

Life cycle

The eggs of this species can also survive when submerged; juveniles can hatch underwater and then climb to the surface.[4]

The life cycle is extremely short, and can take place within less than a month.[4] This species can have up to 5 generations in a year,[4] with several generations alive at the same time.[4] Frequently there are forms with a reduced penis, which reproduce by self-fertilisation.[4] The maximum age of this slug is not more than 1 year.[4]

Parasites

Parasites of Deroceras laeve include:

References

This article incorporates public domain text from the reference [4]

  1. ^ (2006). IUCN Red List of Threatened Species. <www.iucnredlist.org>. Cited 2 March 2007.
  2. ^ Müller O. F. (1774). Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non marinorum, succincta historia. Volumen alterum. pp. I-XXXVI [= 1-36], 1-214, [1-10]. Havniæ & Lipsiæ. (Heineck & Faber).
  3. ^ "Synonyms of Limax laevis (n=17)". AnimalBase, accessed 4 January 2011.
  4. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae Species summary for Deroceras laeve. AnimalBase, accessed 4 January 2011.
  5. ^ a b (Czech) Horsák M., Juřičková L., Beran L., Čejka T. & Dvořák L. (2010). "Komentovaný seznam měkkýšů zjištěných ve volné přírodě České a Slovenské republiky. [Annotated list of mollusc species recorded outdoors in the Czech and Slovak Republics]". Malacologica Bohemoslovaca, Suppl. 1: 1-37. PDF.
  6. ^ Juřičková L, Horsák M, Beran L (2001). "Check-list of the molluscs (Mollusca) of the Czech Republic". Acta Soc. Zool. Bohem. 65: 25–40. 
  7. ^ http://www.anemoon.org/anm/voorlopige-kaarten/landmollusken/wetenschappelijk/deroceras-laeve/
  8. ^ Balashov, I.; Gural-Sverlova, N. (2012). "An annotated checklist of the terrestrial molluscs of Ukraine". Journal of Conchology 41 (1): 91–109. 
  9. ^ Hlaváč, J. Č. (2004). "A new record of Deroceras laeve (O. F. Müller, 1774) from Pakistan (Gastropoda: Pulmonata: Agriolimacidae)". Folia Malacologica 12: 181–182. 
  10. ^ Wiktor, A.; De-niu, C.; Wu, M. (2000). "Stylommatophoran slugs of China (Gastropoda: Pulmonata) – prodromus". Folia Malacologica 8 (1): 3–35. 
  11. ^ Tsai C.-L. & Wu S.-K. (2008). "A New Meghimatium Slug (Pulmonata: Philomycidae) from Taiwan". Zoological Studies 47(6): 759-766. PDF.
  12. ^ Rory J. Mc Donnel, Timothy D. Paine & Michael J. Gormally (2009). Slugs: A Guide to the Invasive and Native Fauna of California. ISBN 978-1-60107-564-2. 
  13. ^ Hausdorf B (May 2002). "Introduced land snails and slugs in Colombia". J. Molluscan Stud. 68 (2): 127–131. doi:10.1093/mollus/68.2.127. PMID 12011238. 
  14. ^ Robinson D. G., Hovestadt A., Fields A. & Breure A. S. H. (July 2009). "The land Mollusca of Dominica (Lesser Antilles), with notes on some enigmatic or rare species". Zoologische Mededelingen 83 http://www.zoologischemededelingen.nl/83/nr03/a13
  15. ^ Michigan Department of Natural Resources and Environment. "Brainworm". accessed 14 December 2010.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!