Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species ranges throughout the Mississippi River drainage from western Pennsylvania to Minnesota, west to Kansas and Nebraska, and south to Arkansas. In the St. Lawrence River system it occurs from Lake Huron to Lake Champlain also in the Canadian Interior Basin in parts of the Red River of the North and the Winnipeg River (Parmalee and Bogan, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The pink heelsplitter occurs in the Mississippi drainage from Pennsylvania, south to northern Alabama and Mississippi, west to eastern Oklahoma and north thorough the eastern Dakotas. In Canada it is found in the Red River of the North and the Winnipeg river. In the St. Lawrence drainage, it is found from Lake Huron to Lake Champlain.

In Michigan Potamilus alatus is found at the lower stretches of rivers in the lower peninsula, and in Lakes Erie and St. Clair.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The pink heelsplitter is up to 20.3 cm (8 inches) long , and is elongate and somewhat rectangular in shape. The shell is large and laterally compressed. A large wing is usually present posterior to the umbos. The   anterior end is sharply rounded, the posterior end broadly rounded and somewhat angled. The angle of the dorsal margin depends on the shape of the wing, and the ventral margin is straight to gently curved.

Umbos are low, being raised only slightly above the hinge line. The beak sculpture is fine, with concentric lines.

The periostracum (outer shell layer) is smooth, dark greek or brown with green rays. Older specimens tend to be more brown or black.

On the inner shell, the   left valve has two   pseudocardinal teeth, which are thin, erect and knobby. The two lateral teeth are short, thin, slightly curved and roughened. The right valve has one erect, triangular, striated pseudocardinal tooth. Anterior to this tooth is a smaller denticle (nacreous swelling). The one lateral tooth is high and slightly curved.

The beak cavity is shallow. The nacre is purple throughout and iridescent throughout, or mainly at the posterior end.

In Michigan, this species can be confused with the white heelsplitter. The white heelsplitter is more round or plate-like in shape.

Range length: 20.3 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species is found on a variety of substrates in slow to swiftly flowing water. It can also adapt to shallow lake and river-lake habitats (Oesch, 1984). Substrates include clay, clay mixed with silt, sand, pea gravel and sand, and cobble/sand/silt (Fichtel and Smith, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The pink heelsplitter can be found in various types of substrate, and in slower moving waters.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth.

Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

Glochidial metamorphosis has not been tested for any fish species yet. However, natural infestations of Potamilus alatus glochidia on the freshwater drum (also called sheephead) have been observed.

Ecosystem Impact: parasite

  • Wilson, C. 1916. Copepod parasites of fresh-water fishes and their economic relations to mussel glochidia. Bulletin of the Bureau of Fisheries. [Issued separately as U.S. Bureau of Fisheries Document 824], 34: 333-374.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: In Minnesota, it occurs in the Red River of the North, St. Croix, Mississippi River drainages (Sietman, 2003; Graf, 1997; Cvancara, 1970). It is generally distributed and common in medium streams in central and S Illinois (Cummings and Mayer, 1997; Schanzle and Cummings, 1991); Fox River basin, and into Wisconsin (dead shell farthest downstream near Illinois River confluence, may be exirpated) (Sietman et al., 2001; Schanzle et al., 2004). It is in the St. Joseph, St. Mary's, Maumee (Pryor, 2005); Tippecanoe (Cummings and Berlocher, 1990) and Muscatatuck drainage in Indiana (Harmon, 1989). In Ohio, it is widespread statewide (not Mahoning) (Watters, 1992; 1995; Lyons et al., 2007; Grabarciewicz, 2008; Hoggarth et al., 2007; Watters et al., 2009); only Cuyahoga mainstem (Smith et al., 2002). In West Virginia, it is in the Upper Ohio/Kanawha (Zeto et al., 1987; Morris and Taylor, 1992). In Tennessee, it is widespread in the Tennessee basin incl. French Broad, Holston, Powell, Clinch, Little Tennessee, Emory, Hiwassee, Sequatchie, Elk, and Duck Rivers. It is also in the Cumberland River and tributaries including Big South Fork Cumberland, Obey, Caney Fork, Stones, Harpeth, and Red Rivers (Parmalee and Bogan, 1998). In Mississippi, it is in the Tennessee River drainage only (Jones et al., 2005). In Alabama it is common but restricted to the Tennessee River system (Mirarchi, 2004) in the Tennessee, Elk and Paint Rock (Ahlstedt, 1996) Rivers and Bear Creek, Colbert Co. and Cypress Creek, Lauderdale Co. (Williams et al., 2008). McGregor and Garner (2004) recently in the Bear Creek drainage, Alabama/Mississippi. It has been collected in Kentucky in the S Fork Kentucky (Evans, 2008), Red (Clark, 1988), Middle Green (Gordon, 1991) and Barren Rivers (Cochran and Layzer, 1993), but is generally statewide (Cicerello and Schuster, 2003). In South Dakota it is not common but in lakes and larger rivers in the Minnesota, Vermillion, and Missouri River drainages (Backlund, 2000); also Lower James (Perkins and Backlund, 2003), Lake Oahe, Lewis and Clark Lake region (Shearer et al., 2005). It reaches its NNE limit in Vermont in Lake Champlain and tributaries below fall lines (Fichtel and Smith, 1995); Missisquoi, Lamoille, Winooski, Poultney Rivers; Otter, Lewis, and Hospital Creeks (Kart et al., 2005). In Michigan, it is in the Clinton (Strayer, 1980); Au Sable, Pine, Bele, and Huron (Badra and Goforth, 2003) drainages. In Wisconsin, it is along the Mississippi and lower Wisconsin Rivers and a narrow line from Shawano to Green Lake Cos.; few more along W edge of state (Mathiak, 1979). In Arkansas, many misidentifications of P. purpuratus are attributed to this species, only confirmed record is 1 specimen from the Mississippi River at West Memphis, Crittenden Co., 1981 (Harris and Gordon, 1987; Harris et al., 1997; Anderson, 2006). In Kansas, it is restricted to the mainstem Kansas River and the Marais des Cygnes River drainage, including Pottawatomie Creek, and the Little Osage, Marmaton, and Marais des Cygnes Rivers (Couch, 1997) and Wakarusa (Tiemann, 2006). In the Little Blue River basin, it survives in the Kansas portion (Hoke, 2004). It is in the Neosho and Illinois drainages and Grand Lake (Branson, 1984). Survey work in the Big Blue River system of SE Nebraska and NE Kansas revealed it in lower (Kansas) reaches of the Big Blue basin including Tuttle Creek Lake and the Big Blue River in Nebraska and lower reaches of Indian Creek in Gage Co. (Hoke, 2005); in the Platte River only in Sarpy Co. (Freeman and Perkins, 1992). In Canada, it is in the Red/ Assiniboine (Watson, 2000) and Winnipeg River systems of Manitoba (Pip, 2006) and lower Great Lakes/ St. Lawrence drainage of Ontario (Metcalfe-Smith et al., 2003) and Quebec; widespread but not abundant and in decline due to zebra mussels in some areas (Metcalfe-Smith and Cudmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: In 1991, it was reported as the third most abundant species in Wheeler Reservoir, with a population of 56,150,000 (Ahlstedt and McDonough, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. Mantle flaps in the lampsilines are modified to attract potential fish hosts. How the pink heelsplitter recognizes and/or attracts its fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

A known glochidial host is the freshwater drum, Aplodinotus grunniens (Howard, 1913; Wilson, 1916; Howard and Anson, 1922; Cummings et al., 1993; Clarke 1981; see also Weiss and Layzer, 1995); confirmed by Brady et al. (2004). Sietman et al. (2009) confirmed freshwater drum (Aplodinotus grunniens) as a host species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Potamilus alatus is a long-term brooder and probably spawns in the summer months in Michigan.

Breeding interval: The pink heelsplitter breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably in the summer months.

Range gestation period: 10 (high) months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Potamilus alatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Potamilus alatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTATTATTGGCTTTGTGGTCTGGTTTGATTGGTTTGGCTTTGAGTCTTTTGATTCGGGCTGAGTTAGGGCAACCCGGTAGGTTGTTGGGGGAT---GATCAGTTGTATAATGTAATTGTAACAGCGCATGCTTTTATGATAATTTTTTTTTTGGTTATGCCAATAATGATTGGGGGTTTTGGTAATTGACTTATTCCTCTTATGGTTGGGGCCCCCGATATAGCTTTTCCTCGGTTGAATAATTTGAGTTTTTGGTTATTAGTGCCGGCTTTGTTTTTGTTGTTGAGTTCTTCTTTAGTGGAGAGAGGTGTTGGGACTGGGTGGACAGTTTACCCGCCAATATCTGGGAATGTGGCTCATTCTGGGGCTTCGGTTGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCTTCTATTTTAGGGGCTATTAATTTTATTTCTACTGTTGGGAATATGCGATCTCCTGGGTTGGTTGCTGAGCGAATCCCGTTGTTTGTGTGAGCTGTTACTGTGACAGCGGTTTTGTTGGTTGCGTCATTGCCTGTTTTGGCTGGTGCTATCACGATGTTGCTTACTGATCGTAATATTAACACGTCTTTCTTTGACCCTGTGGGGGGGGGTGACCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is widespread throughout central North America and is considered stable and secure throughout its range, although some Canadian occurrences are declining as are occurrences at the edge of the range of the species.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: This species is found on a variety of substrates in slow to swiftly flowing water. It can also adapt to shallow lake and river-lake habitats (Oesch, 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LR/lc
Lower Risk/least concern

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Potamilus alatus is listed as Endangered in Vermont.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: lower risk - least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Some Canadian historical sites are now extirpated (Outaouais River and St. Lawrence River close to Montreal, for example) (Metcalfe-Smith and Cudmore-Vokey, 2004). Recently this species has been confirmed to be likely extirpated from the main channel of the Detroit River between Lake St. Clair and Lake Erie, Michigan/Ontario; due to zebra mussel invasion (Schloesser et al., 2006). It was recently documented in the Fox River basin in Illinois and Wisconsin represented only by a single dead specimen at the farthest downstream reach near the Illinois River confluence at Ottawa, Illinois so it may be exirpated from the drainage (Schanzle et al., 2004).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: Only dead shells and subfossil material was found in the Big Sioux River in South Dakota (Skadsen and Perkins, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Zebra mussels threatend the population at the mouth of the South Nation River in the Ottawa River (Schueler and Karstad, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: In the Cuyahoga Valley National Park (between Cleveland and Akron, Ohio), this species was recently found only in the Cuyahoga River mainstem (Smith et al., 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Potamilus alatus

Potamilus alatus is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, commonly known as the river mussels.

This species is native to eastern North America. It is found in the drainages of the Ohio River, the St. Lawrence River, the Great Lakes, and the Canadian Interior Basin.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species was formerly placed in the genus Proptera which was widely used in the 1950s and 1960s. A recent ruling published in the Bulletin of Zoological Nomenclature (ICZN, 1992) recommended retention of the older name Potamilus. In an analysis of systematic relationships of species in the genus Potamilus using DNA sequence data, Roe and Lydeard (1998) concluded that Potamilus is paraphyletic with Leptodea fragilis and Lampsilis ornata nested between Potamilus capax and the remaining Potamilus species (all of which appeared to be monophyletic). This study somewhat cautiously suggests Potamilus purpuratus coloradoensis may represent a species distinct from Potamilus purpuratus as listed doubtfully by Simpson (1914) and, based on genetic distance, P. purpuratus coloradoensis is phenetically more similar to Potamilus alatus (1.2%) than P. purpuratus (1.5%).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!