Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 334 specimens in 1 taxon.
Water temperature and chemistry ranges based on 50 samples.

Environmental ranges
  Depth range (m): 0.025 - 108
  Temperature range (°C): 23.522 - 26.658
  Nitrate (umol/L): 0.409 - 7.152
  Salinity (PPS): 33.397 - 36.938
  Oxygen (ml/l): 3.908 - 4.895
  Phosphate (umol/l): 0.085 - 0.694
  Silicate (umol/l): 0.805 - 6.218

Graphical representation

Depth range (m): 0.025 - 108

Temperature range (°C): 23.522 - 26.658

Nitrate (umol/L): 0.409 - 7.152

Salinity (PPS): 33.397 - 36.938

Oxygen (ml/l): 3.908 - 4.895

Phosphate (umol/l): 0.085 - 0.694

Silicate (umol/l): 0.805 - 6.218
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cerithium atratum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCGGCGGTAGAGAGGGGTGTCGGGACTGGCTGAACCGTTTATCCTCCTTTAGCAGGGAATTTAGCCCATGCGGGAGGGTCGGTCGACTTA---GCTATTTTTTCTCTTCACTTAGCTGGGGTTTCTTCTATTTTAGGAGCTGTAAACTTCATTACCACAATTATTAATATACGATGACGAGGAATACAGTTTGAACGGCTTCCTCTTTTTGTGTGGTCGGTAAAAATCACTGCTGTCCTTTTACTTCTTTCCCTACCTGTGCTTGCAGGT---GCTATTACTATGCTTCTTACTGACCGGAACTTTAATACGGCTTTCTTTGATCCTGCTGGGGGTGGGGACCCTATTTTGTACCAACATCTCTTCTGATTTTTTGGACATCCAGAAGTATATATTTTGATTCTACCTGGATTTGGGATAATTTCACATATCGTGAGCCATTATTCCTCTAAGAAA---GAAACTTTTGGGACTCTTGGAATGATCTATGCTATACTTGCGATTGGTGTATTAGGATTTATTGTATGAGCTCATCATATGTTTACTGTTGGAATAGACGTTGATACTCGAGCTTACTTTACGGCGGCAACAATAATTATTGCTGTTCCTACGGGAATTAAGGTCTTTAGCTGATTA---GCCACAATTCACGGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cerithium atratum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cerithium atratum

Cerithium atratum is a species of sea snail, a marine gastropod mollusk in the family Cerithiidae.[1]

Distribution[edit]

The distribution of Cerithium atratum includes the Western Atlantic.[2]

Description[edit]

The maximum recorded shell length is 50 mm.[3]

Habitat[edit]

Minimum recorded depth is 0 m.[3] Maximum recorded depth is 91 m.[3]

References[edit]

  1. ^ a b Cerithium atratum (Born, 1778).  Retrieved through: World Register of Marine Species on 17 May 2010.
  2. ^ a b c Cerithium atratum. sealifebase.org, accessed 9 January 2011.
  3. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!