Overview

Comprehensive Description

Description

 Aplysia punctata is usually 7 cm long but can grow to 20 cm in length. The body is long and narrow and the parapodia join rather high posteriorly. At the front of the body the anterior tentacles are short, with rounded extensions to the mouth slit while the tentacles on the head (rhinophores) are long and slender. It produces both purple and white secretions when disturbed. The mantle has a large opening (foramen) through which the internal shell may be seen. The internal shell is around 4 cm in length and is transparent and pale amber in colour.The body colour of Aplysia punctata is said to vary with the character of its algal diet. Therefore, juveniles that feed on red algae are red, whereas the adults, which are said to migrate on shore to breed are brownish or greenish in accordance with their diet (e.g. Ulva and Fucus). It is similar to Aplysia fasciata which is larger and can reach lengths of 40 cm, it is also dark brown or black in colour. The eggs are pink and laid in tangled threads.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Maitland (1897) and Jaeckel (1952) reported this species at the Belgian coast, but according to Engel (1936) there are doubts about the reliability of the first one.
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0 - 53
  Temperature range (°C): 11.353 - 24.589
  Nitrate (umol/L): 1.120 - 8.618
  Salinity (PPS): 35.008 - 36.443
  Oxygen (ml/l): 4.602 - 6.346
  Phosphate (umol/l): 0.180 - 0.501
  Silicate (umol/l): 1.681 - 3.727

Graphical representation

Depth range (m): 0 - 53

Temperature range (°C): 11.353 - 24.589

Nitrate (umol/L): 1.120 - 8.618

Salinity (PPS): 35.008 - 36.443

Oxygen (ml/l): 4.602 - 6.346

Phosphate (umol/l): 0.180 - 0.501

Silicate (umol/l): 1.681 - 3.727
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Aplysia punctata occurs mainly in very shallow water and occasionally on the lower shore or in rock pools.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aplysia punctata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACACTATATATAATCTTCGGAATGTGATGTGGGTTGGTAGGAACAGGTTTAAGATTATTAATTCGATTCGAACTTGGAACTGCTGGGGCCTTTTTAGGGGAC---GATCATTTTTACAATGTGATTGTAACTGCTCATGCCTTTGTAATAATTTTTTTCATGGTTATACCTATTATAATTGGTGGATTCGGAAACTGAATAGTACCTCTACTTATTGGTGCCCCCGATATAAGTTTTCCCCGTATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCATTTTTACTTCTCCTAGTCTCTAGCCTAATAGAGGGTGGAGCAGGAACTGGGTGGACGGTGTACCCTCCTCTATCAGGTCCTATTGCTCATGGAGGAACTTCTGTTGATTTAGCTATTTTTTCTCTACACTTGGCGGGGATATCGTCTATTTTAGGTGCTATTAATTTCATTACTACTATCTTTAATATACGTTCACCAGGGATCACTTTTGAGCGTCTTAGTTTATTTGTGTGATCTGTACTAGTAACTGCTTTTTTACTTCTTCTTTCTTTGCCTGTATTGGCTGGTGCTATTACTATGCTCTTAACTGACCGTAATTTTAATACTAGATTCTTTGATCCGGCTGGAGGGGGAGACCCTATCTTATATCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aplysia punctata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aplysia punctata

Aplysia punctata is a species of sea slug, a sea hare, a marine opisthobranch gastropod mollusk in the family Aplysiidae, the sea hares. [1]

The rhinophore of Aplysia punctata contains a groove, which extends to about two third of the total length of the rhinophore.[2]

Secondary metabolites (alkaloids) from marine sponges stimulate neurons in the rhinophore ganglion of the rhinophore of Aplysia punctata.[3]

References

This article incorporates CC-BY-2.0 text from reference.[2]

  1. ^ a b Gofas, S. (2011). Aplysia punctata. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138758 on 2012-03-31
  2. ^ a b Wertz A., Rössler W., Obermayer M. & Bickmeyer U. (6 April 2006) "Functional neuroanatomy of the rhinophore of Aplysia punctata". Frontiers in Zoology 3: 6. doi:10.1186/1742-9994-3-6
  3. ^ Bickmeyer U., Drechsler C., Kock M. & Assmann M. (July 2004) "Brominated pyrrole alkaloids from marine Agelas sponges reduce depolarization-induced cellular calcium elevation". Toxicon 44: 45-51. doi:10.1016/j.toxicon.2004.04.001
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
  • Muller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!