Overview

Distribution

Sea Hares are marine animals that inhabit coastal regions thick with vegetation. This particular species, Aplysia californica, ranges from Northern California to Baja California.

Biogeographic Regions: pacific ocean (Native )

  • Grzimek, B. 1968. Grzimek's Animal Life Encyclopedia (vol. 3-Mollusks and Echinoderms). New York: Van Nostrand Reinhold Company.
  • Meinkoth, N. 1981. The Audubon Society Field Guide to North American Seashore Creatures. New York: Alfred A. Kuopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The California Black Sea Hare is probably the world's largest gastropod. It can weigh up to 35 pounds! It is typically about 16" long (41 cm) and 8" (20 cm) wide and high. Plump and soft, it has winglike flaps around the top of its head on both sides. Aplysia californica can be reddish, brownish, or greenish, spotted with white or dark circles and lines. The colors reflect the type and color of algae they are prone to eat. They feed with a pair of jaws and a grasping radula. On top of their head, two pairs of antennae are found: one low near the mouth and another behind the eyes. A foot used to help in locomotion extends a little farther than the entire length of the animal. The anterior tentacles are much larger and ear-like (thus its common name- the sea hare) than the second pair which are used more for smelling. They also possess winglike flaps called parapodia that are used for swimming. The mantle folds over and covers a thin, transparent, and flexible shell. In its wall are unicellular glands that secrete a purple dye when the animal is handled. The sea hare does possess a developed nervous and digestive system. In its digestive tract there is an alimentary canal in front of the stomach that ends in a crop lined with horny plates for better mastication before digestion of food.

Other Physical Features: ectothermic ; bilateral symmetry

  • Nichols, D. 1979. The Oxford Book of Invertebrates. New York, New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Aplysia californica are marine animals that inhabit coastal regions thick with vegetation. This particular species ranges from Northern California to Baja California. They can usually be found crawling around the seaweed they use as a source of food. The younger generation live in the deeper waters where they are born while the adult generation lives in shallow, sheltered places with low tide.

  • Borradaile, L., F. Potts. 1963. The Invertebrata: A Manual for the use of Students. Cambridge: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Aplysia californica are herbivorous and feed on a variety of algae and eelgrass. Their pair of jaws and broad rasp-like radula help crop the seaweed they eat. The color of the particular animal matches the color of the algae or vegetation they feed on the most.

  • Buchsbaum, M., R. Buchsbaum, V. Pearse, J. Pearse. 1989. Living Invertebrates. Pacific Grove, California: The Boxwood Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

A. californica is hermaphroditic. Armed with a single aperture and duct for the sperm and ova, this species reproduces sexually. They travel to deeper waters to spawn around spring time. Once fertilized, their eggs are laid down in pink, gelatin-like stringed sacs coiled around seaweed or rocks.

  • Borradaile, L., F. Potts. 1963. The Invertebrata: A Manual for the use of Students. Cambridge: Cambridge University Press.
  • Nichols, D. 1979. The Oxford Book of Invertebrates. New York, New York: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Polypeptide inhibits microbial growth: California sea hare
 

The California sea hare inhibits microbial growth using escapin, a polypeptide.

   
  "Escapin's antimicrobial effects, bacteriostasis and bactericidal, were determined using a combination of two assays: (1) incubation of bacteria on solid media followed by assessment of inhibition by direct observation of zones of inhibition or by turbidity measurements; and (2) incubation of bacteria in liquid media followed by counting viable colonies after growing on agar plates. Native escapin inhibited the growth of Gram-positive and Gram-negative bacteria, including marine bacteria (Vibrio harveyii and Staphylococcus aureus) and pathogenic bacteria (Staphylococcus aureus, Streptococcus pyogenes and Pseudomonas aeruginosa). Escapin also inhibited the growth of yeast and fungi, with different efficacies. Escapin's antimicrobial activity was concentration dependent and did not decrease when stored for more than 5 months at room temperature. Escapin was bacteriostatic and not bactericidal in minimal media (e.g. salt media) with glucose, yeast extract, and a mixture of 20 amino acids each at 50 µmol l-1, but was bactericidal in media enriched with Tryptone Peptone. Escapin was also strongly bactericidal in media with L-lysine at concentrations as low as 3 mmol l-1 and slightly bactericidal in 50 mmol l-1 L-arginine, but not in most other amino acids even at 50 mmol l-1. Escapin had high oxidase activity (producing hydrogen peroxide) with either L-arginine or L-lysine as a substrate and little to no oxidase activity with other L-amino acids. Hydrogen peroxide alone (without escapin or amino acids) was strongly bacteriostatic but poorly bactericidal, similar in this respect to L-arginine but different from L-lysine in the presence of escapin. Together these results suggest that there are multiple mechanisms to escapin's antimicrobial effects, with bacteriostasis resulting largely or entirely from the effects of hydrogen peroxide produced by escapin's LAAO activity, but bactericidal effects resulting from lysine-dependent mechanisms not directly involving hydrogen peroxide." (Yang et al. 2005:3609)
  Learn more about this functional adaptation.
  • Yang, H.; Johnson, P. M.; Ko, K. C.; Kamio, M.; Germann, M. W.; Derby, C. D.; Tai, P. C. 2005. Cloning, characterization and expression of escapin, a broadly antimicrobial FAD-containing l-amino acid oxidase from ink of the sea hare Aplysia californica. Journal of Experimental Biology. 208(18): 3609-3622.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aplysia californica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGCGATGATTGTTTTCGACTAATCATAAAGATATTGGAACATTATATATAATTTTTGGAATGTGATGTGGTTTAGTGGGAACAGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCTGGAGCTTTCCTAGGGGAT---GATCACTTCTATAATGTTATTGTAACTGCTCACGCTTTTGAAATGATTTTTTTTATAGTTATGCCTATTATAATTGGTGGATTCGGGAATTGAATGGTACCTTTATTAATTGGTGCTCCTGATATAAGATTTCCTCGTATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCCTTTTTACTTCTTTTAGTCTCTAGACTAATAGAAGGTGGAGCTGGAACAGGATGAACAGTTTACCCTCCTCTATCAGGTCCTATTGCACATGGAGGAACTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGGATGTCTTCAATTTTAGGTGCTATTAATTTTATTACTACTATTTTTAATATACGATCGCCAGGAATTACTTTTGAGCGATTAAGCTTATTTGTTTGATCTGTTCTAGTAACAGCTTTCTTACTTCTTCTTTCTTTACCAGTATTAGCTGGTGCTATTACGATGCTTTTAACGGATCGTAATTTTAATACGAGCTTCTTCGACCCTGCGGGAGGAGGAGATCCTATTTTATATCAACACTTGTTCTGATTTTTTGGTCATCCAGAGGTATATATTTTAATTTTACCCGGATTTGGAATAATTTCTCATATTTTGAGTAATTTCTCT---TCCAAGCCTGCTTTTGGAACTTTAGGTATGATTTACGCTATAATTTCTATTGGAATTTTAGGATTTATTGTGTGAGCTCATCACATATTCACTGTAGGAATGGATGTTGATACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aplysia californica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 10 specimens with morphological vouchers housed at Florida Museum of Natural History and Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Aplysia californica are used extensively in studies of behavior, reproduction, and development in such fields as chemistry, biology, and psychology.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

California sea hare

The California sea hare, also known as the California sea slug, scientific name Aplysia californica, is a species of sea slug, specifically a sea hare, a marine opisthobranch gastropod mollusk in the sea hare family, Aplysiidae.[1]

Distribution[edit]

Map of the range of the California sea hare. Occurrence is sparse in the northern portion of this range.[2]

This species is found on the Pacific coast of California (North America) and northern Mexico but can be also found off the beaches of Florida. Aplysia inhabit the photic zone to graze on algae, mainly the intertidial and sub-littoral zones usually not deeper than 18-20 m.[3]

Description[edit]

The maximum length recorded for the California sea hare is seventy-five cm (thirty inches) when crawling and thus fully extended, although most adult specimens are half this size or smaller. Adult animals can weight up to 7 kg.[4] A closely related species, Aplysia vaccaria, the black sea hare, can grow to be larger still.

Predators[edit]

Because of the toxins in its body that come from consuming algae, the California sea hare has very few predators. Among these, however, is the giant green anemone, which reportedly takes them in large numbers; however, the anemone will capture a sea hare and then proceed to digest only 67-85% of it before regurgitating the remains. This is because the anemone consumes only enough of the sea hare to expose the sea hare's digestive gland and its associated toxins. Once this gland has been exposed, it causes the anemone to reject all of the remaining undigested animal, including parts it would otherwise have taken in as food.[5] Other predators include starfish, lobsters,[6] and the ophistobranch Navanax inermis which will take juveniles.[7]

When it is considerably disturbed, the sea hare is capable of releasing two different kinds of ink from different locations within its mantle cavity, much in the way an octopus does. One ink is reddish-purple and comes from what is called the purple ink gland, while the other is milky white, comes from what is called the opaline gland, and contains the aversive chemical opaline.

Close-up showing the rhinophores of Aplysia californica

Life cycle[edit]

Aplysia californica out of water at low tide near Morro Bay

Like all sea hares, the California sea hare is hermaphroditic, acting as male and female simultaneously during mating. Aplysia is known to form mating chains with up to 20 animals, thus each animal can serve as male and female at the same time. The eggs are yellow-green, and change after 8 to 9 days into a brown color before larvae hatch. Mating is most prominent during the summer month following the rise of the water temperature to 17 degrees Celsius. Aplysia has a generation time of 19 weeks: Day 1-37 after hatching from the egg planktonic stage, day 34-37 Metamorphic stage, day 45-80 juvenile stage (35 days in total). Reproductive maturity is reached 85 days after hatching (133 days after deposition of the fertilized eggs). The development of the nervous system lasts for a total of 140 days [8] The life span is assumed to be around a year, yet older animals have been found. Cooler temperature delays spawning and has been shown to extend the lifespan.

Sexual reproduction[edit]

At the base of the right anterior tentacle is the aperture from which the penis can protrude. The genital aperture lies at the anterior end of the mantle cavity, a seminal grove arises from it and runs forward to the penis, at the base of the anterior tentacle.

Coupling lasts for hours or sometimes for days, although the actual passage of the sperm may take only a few minutes. Egg laying normally has to be triggered by copulation, but it occurs spontaneously in individuals kept in isolation for up to 3-4 months (typically these eggs are unfertilized).[8] Copulation occurs most frequently in the early morning, and only rarely after 12:30 pm.[9] An individual animal weighing 2,600g was recorded to have laid about 500 million eggs at 27 separate times during less than five months.

Feeding habits[edit]

Like all Aplysia species, the California sea hare is herbivorous. Its diet consists primarily of red algae like Laurencia pacifica, Plocamium pacificum, and Ceramium eatonianum, which gives the animal its typically reddish or pinkish coloration. Thus Aplysia resembles the food it grazes on and cannot be distinguished easily from the seaweed unless the animal is moving.[8]

Laboratory use[edit]

Aplysia californica has become a valuable laboratory animal, used in studies of the neurobiology of learning and memory, and is especially associated with the work of Nobel Laureate Eric Kandel.

Its ubiquity in synaptic plasticity studies can be attributed to its simple nervous system, consisting of just 20,000 large, easily identified neurons with cell bodies up to 1 mm in size. Despite its seemingly simple nervous system, however, Aplysia californica is capable of a variety of non-associative and associative learning tasks, including sensitization, habituation, and classical and operant conditioning. Study typically involves a reduced preparation of the gill and siphon withdrawal reflex.

Genomics[edit]

The sequencing of the whole genome was approved as a priority by National Human Genome Research Institute on March 2005.[10][11] The draft genome is available on the UCSC Genome browser.[12]

References[edit]

  1. ^ a b Rosenberg, G.; Bouchet, P. (2011). Aplysia californica J. G. Cooper, 1863. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=240765 on 2012-03-31
  2. ^ Robert Hugh Morris; Eugene Clinton Haderlie (1980). Intertidal Invertebrates of California. Stanford University Press. p. 348. ISBN 978-0-8047-1045-9. Retrieved 26 July 2013. 
  3. ^ Kandel, Eric. R. (1979). Behavioral Biology of Aplysia: Contribution to the Comparative Study of Opistobranch Molluscs. San Francisco: W. H. Freeman and Company. 
  4. ^ MacFarland, F.M. (1966). Studies of the opisthobranchiate mollusks of the Pacific coast of North America. Mem. Calif. Acad. Sc. VI, p. 1-596
  5. ^ Beeman, Robert D.; Williams, Gary C. (1980). "Chapter 14: Opisthobranchia and Pulmonata: The sea slugs and allies". In Morris, Robert Hugh; Haderlie, Eugene Clinton. Intertidal Invertebrates of California. Stanford University. p. 313. ISBN 978-0-8047-1045-9. Retrieved 23 July 2013. 
  6. ^ Watkins et al. Lobster attack induces sensitization in the sea hare, Aplysia californica. J Neurosci. 2010 Aug 18;30(33):11028-31.
  7. ^ Janet L. Leonard and Ken Lukowiak. The Behavior of Aplysia californica Cooper (Gastropoda; Opisthobranchia): I. Ethogram. Behaviour Vol. 98, No. 1/4 (Aug., 1986), pp. 320-360
  8. ^ a b c Kandel, Eric Behavioral biology of Aplysia. W.H. Freeman and Co., San Francisco.
  9. ^ Newby 1972
  10. ^ Approved Sequencing Targets. Last updated 14 September 2009. Accessed 24 November 2009
  11. ^ National Human Genome Research Institute (1 March 2005) "NHGRI Targets 12 More Organisms for Genome Sequencing". NIH new Releases, Last Updated: 12 June 2009.
  12. ^ [1]
  • Beeman R.D. (1963) Notes on the California species of Aplysia (Gastropoda: Opisthobranchia). The Veliger 5(4): 145-147.
  • Bebbington A. (1977) Aplysiid species from Eastern Australia with notes on the Pacific Ocean Aplysiomorpha (Gastropoda, Opisthobranchia). Transactions of the Zoological Society of London 34: 87-147
  • urgeon, D.; Quinn, J.F.; Bogan, A.E.; Coan, E.V.; Hochberg, F.G.; Lyons, W.G.; Mikkelsen, P.M.; Neves, R.J.; Roper, C.F.E.; Rosenberg, G.; Roth, B.; Scheltema, A.; Thompson, F.G.; Vecchione, M.; Williams, J.D. (1998). Common and scientific names of aquatic invertebrates from the United States and Canada: mollusks. 2nd ed. American Fisheries Society Special Publication, 26. American Fisheries Society: Bethesda, MD (USA). ISBN 1-888569-01-8. IX, 526 + cd-rom pp.
  • NIH/University of Miami National Resource for Aplysia Facility

Further reading[edit]

The anterior part of Aplysia californica
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!