Overview

Distribution

Eastern Atlantic and Mediterranean, from France to Angola
  • Rolán E., 2005. Malacological Fauna From The Cape Verde Archipelago. Part 1, Polyplacophora and Gastropoda.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Paratype for Aplysia willcoxi Heilprin, 1886
Catalog Number: USNM 710920
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): K. Clark
Year Collected: 1975
Locality: Titusville, Florida, United States, North Atlantic Ocean
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 40 samples.

Environmental ranges
  Depth range (m): 0 - 42
  Temperature range (°C): 16.269 - 25.634
  Nitrate (umol/L): 0.501 - 1.979
  Salinity (PPS): 36.080 - 37.969
  Oxygen (ml/l): 4.454 - 5.382
  Phosphate (umol/l): 0.100 - 0.229
  Silicate (umol/l): 0.805 - 1.778

Graphical representation

Depth range (m): 0 - 42

Temperature range (°C): 16.269 - 25.634

Nitrate (umol/L): 0.501 - 1.979

Salinity (PPS): 36.080 - 37.969

Oxygen (ml/l): 4.454 - 5.382

Phosphate (umol/l): 0.100 - 0.229

Silicate (umol/l): 0.805 - 1.778
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aplysia fasciata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACATAATTTTTGGAATGTGATGTGGTTTAGTAGGAACGGGTTTAAGTCTTTTAATTCGATTTGAGCTTGGTACTGCTGGAGCTTTCCTAGGGGAT---GATCACTTCTATAATGTTATTGTAACTGCTCACGCTTTCGTAATAATTTTTTTCATAGTTATGCCTATTATAATTGGTGGATTGGGGAATTGAATGGTACCTTTATTAATTGGTGCTCCTGATATGAGATTTCCTCGTATAAACAACATGAGTTTCTGACTTCTTCCTCCTTCCTTTTTACTTCTTTTAGTTTCTAGACTAATAGAAGGTGGAGCTGGAACAGGATGAACAGTTTATCCTCCTTTGTCAGGTCCTATTGCACATGGAGGAACTTCTGTTGATTTAGCTATTTTTTCCTTACACCTAGCAGGGATGTCTTCAATTTTAGGTGCTATTAATTTTATTACTACTATTTTTAATATACGATCGCCAGGAATTACTTTTGAGCGATTAAGCTTATTTGTTTGATCTGTTCTGGTAACAGCTTTCTTACTTCTTCTCTCTCTACCAGTACTAGCTGGTGCTATTACGATGCTTTTAACTGATCGCAATTTTAATACGAGCTTCTTTGATCCTGCGGGAGGGGGAGATCCTATTTTATATCAACACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aplysia fasciata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aplysia fasciata

Aplysia fasciata, common name the "mottled sea hare", or the "sooty sea hare", is a species of sea hare or sea slug, a marine opisthobranch gastropod mollusk in the family Aplysiidae. [1]

Distribution

This sea hare occurs in the Western Atlantic from New Jersey to Brazil, and in the Eastern Atlantic including the coast of Ghana.

Some consider the species Aplysia brasiliana, found in the Atlantic coast of the Americas, to be a synonym of Aplysia fasciata with just a different regional colour pattern.

Description

A sea hare swimming in a tide pool in Póvoa de Varzim, Portugal.

The length is up to 40 cm. The color is often black or dark brown with an orange or red line.

References

  1. ^ a b Gofas, S. (2012). Aplysia fasciata Poiret, 1789. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=138755 on 2012-03-31
  • Abbott, R.T. (1974). American Seashells. 2nd ed. Van Nostrand Reinhold: New York, NY (USA). 663 pp.
  • Vine, P. (1986). Red Sea Invertebrates. Immel Publishing, London. 224 pp.
  • Turgeon, D.; Quinn, J.F.; Bogan, A.E.; Coan, E.V.; Hochberg, F.G.; Lyons, W.G.; Mikkelsen, P.M.; Neves, R.J.; Roper, C.F.E.; Rosenberg, G.; Roth, B.; Scheltema, A.; Thompson, F.G.; Vecchione, M.; Williams, J.D. (1998). Common and scientific names of aquatic invertebrates from the United States and Canada: mollusks. 2nd ed. American Fisheries Society Special Publication, 26. American Fisheries Society: Bethesda, MD (USA). ISBN 1-888569-01-8. IX, 526 + cd-rom pp. (look up in IMIS)

page(s): 122

  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213 (
  • Martinez E. & Ortea J. (2002). On the synonymy between Aplysia winneba Eales, 1957 and Aplysia fasciata Poiret, 1789 (Mollusca: Opisthobranchia: Anaspidea). Iberus 20(2): 11-21
  • Rolán E., 2005. Malacological Fauna From The Cape Verde Archipelago. Part 1, Polyplacophora and Gastropoda.
  • Rosenberg, G., F. Moretzsohn, and E. F. García. 2009. Gastropoda (Mollusca) of the Gulf of Mexico, Pp. 579–699 in Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!