Overview

Brief Summary

The "pteropod" Clione limacina belongs to a group of marine gastropod mollusks that lack shells. This species has been the subject of extensive investigations into the neurobiology of swimming behavior. Its geographic distribution was long considered to include both the northern and southern ends of the Earth, with northern and southern hemisphere subspecies. However, work by Gilmer and Lalli (1990) suggested that southern populations should possibly be treated as a distinct species, C. antarctica. Clione limacina is widely distributed in the North Atlantic and Subarctic Oceans and is found also in the North Pacific Ocean and along the Atlantic coast of North America in the waters of the cold Labrador current south to the Cape Hatteras region (around 35 N).

Clione limacina breeds and spawns in all types of water masses within the vertical range it commonly inhabits, i.e., from the surface to around 500 m. The most intensive spawning is correlated with the spring/summer period of annual heating of local water and the highest abundance parallels maximum growth of phytoplankton, which serves as food for veliger larvae and early polytrochous larvae. After the end of this period, spawning intensity in local C. limacina populations declines sharply, although spawning continues at low intensity during the autumn/winter season.

Clione limacina feeds exclusively on shelled "pteropods", such as Limacina helicina (Lalli and Gilmer, 1989). Only the veliger stage ofC. limacina does not feed on Limacina, instead consuming phytoplankton during this life stage. However, 48 to 72 h after metamorphosis from the veliger stage to polytrochous larvae (at around 0.3 mm length) C. limacina begin feeding on Limacina veligers. At sizes greater than 0.6 mm, C. limacina begin to consume metamorphosed Limacina prey and they do so exclusively once they exceed 1.75 to 2 mm in length. Clione capture their Limacina prey with their six buccal cones and the proboscis is used to draw the body out of the shell (the neurophysiology of buccal cone function was investigated by Norekian and Satterlie (1993). The feeding specialization of Clione is reflected in numerous adaptations. Because even the early polytrochous larvae of Clione feed on Limacina, the life cycles of predator and prey are necessarily closely synchronized. The feeding behavior of C. limacina is described in detail by Lalli and Gilmer (1989) and Hermans and Satterlie (1992).

See additional images and information at the Sea Slug Forum for both the arctic and antarctic forms

(Mileikovsky 1970; Lalli and Gilmer1989; Gilmer and Lalli 1990; Hermans and Satterlie 1992)

  • Lalli, C.M. and R.W. Gilmer. 1989. Pelagic Snails: The Biology of Holoplanktonic Gastropod Mollusks. Stanford University Press, Palo Alto, California.
  • Gilmer, R.W. & Lalli, C.M. 1990. Bipolar variation in Clione, a gymnosomatous pteropod. American Malacological Union Bulletin 8(1): 67-75.
  • Hermans, C.O. and R.A. Satterlie. 1992. Fast-strike feeding behavior in a pteropod mollusk, Clione limacina Phipps. Biological Bulletin 182:1-7.
  • Mileikovsky, S.A. 1970. Breeding and larval distribution of the pteropod Clione limacina in the North Atlantic, Subarctic and North Pacific Oceans. Marine Biology 6: 317--334.
  • Norekian, T.P. and R.A. Satterlie. 1993. Co-activation of antagonistic motoneurons as a mechanism of high-speed hydraulic inflation of prey capture appendages in the pteropod mollusk Clione limacina. Biological Bulletin 185: 240-247.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

The most common naked pteropod of arctic waters
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barrel-shaped body with paddle-like lateral wings; No external gills; Transparent body with orange-red colouration in the tail and horn-like mouth organs; Tentacles and hooks deployed during feeding; Reddish-brown visceral mass is seen through the body wall; Several subspecies and forms recognized, with differing shell shape and differeing polar/subpolar distribution
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Barents Sea, Belgian Exclusive Economic Zone, Canada Basin, Canadian Exclusive Economic Zone [Pacific part], Canadian part of the Arctic Ocean, Chukchi Sea, Cobscook Bay, European waters (ERMS scope), FAO fishing area 67, Gulf of Maine, Gulf of St. Lawrence, Hudson Bay, Hudson Strait, North East Pacific, North Pacific, North West Atlantic, Portuguese Exclusive Economic Zone, Saint Andrews, Spanish Exclusive Economic Zone, Storfjordrenna, Storfjords, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic seas to North Carolina; Alaska-Canada-Northern Europe
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Panarctic, bipolar and subpolar; Epipelagic (shallow dwelling)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Mesopelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epipelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

upper epipelagic and glacial
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1477 specimens in 3 taxa.
Water temperature and chemistry ranges based on 1180 samples.

Environmental ranges
  Depth range (m): 0 - 1510
  Temperature range (°C): -1.854 - 13.798
  Nitrate (umol/L): 0.007 - 45.133
  Salinity (PPS): 20.476 - 35.575
  Oxygen (ml/l): 0.471 - 9.319
  Phosphate (umol/l): 0.055 - 3.321
  Silicate (umol/l): 1.403 - 158.199

Graphical representation

Depth range (m): 0 - 1510

Temperature range (°C): -1.854 - 13.798

Nitrate (umol/L): 0.007 - 45.133

Salinity (PPS): 20.476 - 35.575

Oxygen (ml/l): 0.471 - 9.319

Phosphate (umol/l): 0.055 - 3.321

Silicate (umol/l): 1.403 - 158.199
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

An active swimmer while hunting for its shelled pteropod prey, primarily Limacina helicina; Feeding apparatus consists of 3 pairs of buccal cones (finger-like tentacles), 2 clusters of long hooks, and a toothed radula (a chain-saw like tongue) all normally hidden inside the head and body; Feeding apparatus is everted (pushed out) during feeding to extract the prey from their shells; A well-feed animal has a large dark gut
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

protandrous hermaphrodite (males first, females later); mating involves cross-fertilization; 30-40 eggs laid as oblong gelatinous egg strips (1 to 1.2 mm long); Newly hatched larvae have thimble-shaped shells and a ciliated velum aroudn mouth; shell is soon cast off and while changing to adult body form, 2 ciliated rings lost are visible mid-body and near the tail; Generation times thought to be 1 year in the arctic and perhaps 2 per year in the subarctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Clione limacina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTCTTTATCTTTTATTTGGGCTATGGAGAGCCCTTGTAGGCTCTGCCTTTTCTGTTTTGATTCGAATAGAATTAGGATCTACTACCATCATTCTAGGTTCT---CCTCATTTATACAATGTATTGGTTACAGCCCATGCTTTTGTTATAATTTTCTTCTTTGTAATGCCTGTTTTAATTGGGGGGTTTGGAAATTGAATGCTACCTCTATTGGTAGGTGCTGCTGATATGGCGTTCCCTCGCCTAAACAACATGAGATTCTGGTTTCTTCCTCCTGCAATAATTCTATTGCTAGTATCTTCTTTAGTAGAGGGAGGAGTGGGTACAGGTTGAACTGTTTACCCTCCACTAAGATCGTTAGTAGGACATAATAACCACTCTGTTGATCTAGCTATTTTTTCTTTACACTTAGCTGGTATTAGGTCTATTTTAGGTGCAGTAAATTTTATTACTACTATCTTAAATATACGAGCCCCTGGAGTTAGCTGAGAACGACTATCTCTATTTGTGTGGTCTCTTTTAGTAACAACAGTTCTTCTACTTTTATCTCTTCCTGTATTGGCAGGAGCTATTACTATACTCCTTACTGACCGTAATTTCAATACAGGGTTCTTTGACCCTGGGGCCGGTGGAGACCCTATTTTATTTCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Clione limacina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clione limacina

Clione limacina, common name Naked Sea Butterfly, Sea Angel, and Common Clione, is a sea angel found from the surface to greater than 500 m in depth.[3],[2] It lives in the Arctic Ocean and cold regions of the North Pacific and North Atlantic Oceans. It was first described by Martens in 1676 and became the first gymnosomatous (without a shell) "pteropod" to be described.[4]

Contents

Subspecies

Distribution

Clione limacina is found in cold waters of the Arctic Ocean, North Pacific Ocean and North Atlantic Ocean.[6] A closely related species, Clione antarctica, is found in Antarctic waters.

Description

There are two races that differentiate in body length.[7] Northern race lives in colder water and its size is 70–85 mm.[7] The size of the southern race is 12 mm.[7]

The neurobiology of this pteropod has been studied in detail.

Ecology

Clione limacina inhabits both the epipelagic and mesopelagic regions of the water column.[5]

Feeding habits

They feed in a predator-prey relationship only on the sea butterflies of the genus Limacina: on Limacina helicina and on Limacina retroversa.[7][3] The feeding process of Clione limacina is somewhat extraordinary. The buccal apparatus consists of three pairs of buccal cones. These tentacles grab the shell of Limacina helicina. When the prey is in the right position, with its shell opening facing the radula of Clione limacina, it then grasps the prey with its chitinous hooks, everted from hook sacs. Then it extracts the body completely out of its shell and swallows it whole.[8]

It can survive one year without food.[9] Under such exceptional starvation in the laboratory the length of slugs have changed on average from 22.4 to 12 mm.[9]

Life cycle

Sexes are separate but are seldom conspicuously different externally, simultaneous hermaphrodites yet self-fertilization is prevented due to various morphological, physiological, or behavioral mechanisms.[5] Generally, marine gastropods shed their eggs.[5]

Clione limacina is a prey of planktonic feeders, such as the baleen whales,[7] which historically led to sailors naming it "whale-food".[10] Some fishes are also its predators.[7]

References

This article incorporates CC-BY-SA-3.0 text from the reference [5]

  1. ^ Phipps, C.J., 1774. A voyage towards the North Pole undertaken by His Majesty's Command 1773 : i-viii, 1-253
  2. ^ a b Gofas, S. (2012). Clione limacina. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=139178 on 2012-07-23
  3. ^ a b Lalli C. M. & Gilmer R. W. (1989). Pelagic Snails. The biology of holoplanktonic gastropod molluscs. Stanford University Press: Stanford, California. page 188.
  4. ^ Spitzbergiscbe oder grönlandische Reisebeschreibung, p. 189, p1. P. fig. f.
  5. ^ a b c d e f Gofas, S. (2011). Clione limacina. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=139178 on 2011-01-29
  6. ^ Mileikovsky S.A. (1970) Breeding and larval distribution of the pteropod Clione limacina in the North Atlantic, Subarctic and North Pacific Oceans. Marine Biology 6(4): 317-334.
  7. ^ a b c d e f Böer M., Gannefors C., Kattner G., Graeve M., Hop H. & Falk-Petersen S. (2005). "The Arctic pteropod Clione limacina: seasonal lipid dynamics and life-strategy". Marine Biology 147(3): 707-717. doi:10.1007/s00227-005-1607-8.
  8. ^ Hermans C. O. & Satterlie R. A. (1992). "Fast-strike feeding behavior in a pteropod mollusk, Clione limacina Phipps". The Biological Bulletin, Marine Biological Laboratory, 182: 1-7.
  9. ^ a b Böer M., Graeve M. & Kattner G. (2006). "Exceptional long-term starvation ability and sites of lipid storage of the Arctic pteropod Clione limacina". Polar Biology 30(5): 571-580. doi:10.1007/s00300-006-0214-6.
  10. ^ Gosse, Philip Henry (1854). Mollusca. Natural History. Society for Promoting Christian Knowledge. p. 72. 

Further reading

  • http://www.seaslugforum.net/factsheet/cliolima accessed 5 January 2010
  • (Danish) Boas J. E. V. (1888). "Spolia Atlantica. Bidrag til Pteropodernes. Morfologi og Systematik samt til Kundskaben om deres geografiski Udbredelse". Det Kongelige Danske videnskabernes selskabs skrifter. København, serie 6, number 4: 1-231. Pages 162-166. Plate 7, figure 101-103.
  • Abbott, R.T. (1974). American Seashells. 2nd ed. Van Nostrand Reinhold: New York, NY (USA). 663 pp
  • Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
  • Conover R. J. & Lalli C. M. (1972). "Feeding and growth in Clione limacina (Phipps), a pteropod mollusc". Journal of Experimental Marine Biology and Ecology 9(3): 279-302. doi:10.1016/0022-0981(72)90038-X.
  • Falk-Petersen S., Sargent J. R., Kwasniewski S., Gulliksen B. & Millar R.-M. (2001). "Lipids and fatty acids in Clione limacina and Limacina helicina in Svalbard waters and the Arctic Ocean: trophic implications". Polar Biology 24(3): 163-170. doi:10.1007/s003000000190.
  • Gilmer R. W. & Lalli C. M. (1990). "Bipolar variation in Clione, a gymnosomatous pteropod". Am. Malacol. Union Bull. 8(1): 67-75.
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
  • Gosliner T. (1987). Nudibranchs of southern Africa: A guide to Opisthobranch molluscs of southern Africa. Sea Challengers, Monterey. ISBN 0-930118-13-8
  • Gosner, K.L. 1971. Guide to identification of marine and estuarine invertebrates: Cape Hatteras to the Bay of Fundy. John Wiley & Sons, Inc. 693 p.
  • Hermans C. O. & Satterlie R. A. (1992). "Fast-Strike Feeding Behaviour in a Pteropod Mollusk, Clione limacina Phipps". The Biological bulletin, Marine Biological Laboratory, 182: 1-7.
  • Linkletter, L.E. 1977. A checklist of marine fauna and flora of the Bay of Fundy. Huntsman Marine Laboratory, St. Andrews, N.B. 68 p.
  • Morton J. E. (1958). "Observations on the gymnosomatous pteropod Clione limacina (Phipps)". Journal of the Marine Biological Association of the United Kingdom 37: 287-297.
  • Muller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
  • Thomas, M.L.H. (ed.). 1983. Marine and coastal systems of the Quoddy Region, New Brunswick. Canadian Special Publication of Fisheries and Aquatic Sciences 64. 306 p.
  • Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
  • Rosenthal, J. J. C.; Seibel, B. A.; Dymowska, A.; Bezanilla, F. (2009). "Trade-off between aerobic capacity and locomotor capability in an Antarctic pteropod". Proceedings of the National Academy of Sciences 106 (15): 6192–6196. doi:10.1073/pnas.0901321106. PMC 2669364. PMID 19325127.  edit
  • Turgeon, D.D., et al. 1998. Common and scientific names of aquatic invertebrates of the United States and Canada. American Fisheries Society Special Publication 26
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!