Overview

Comprehensive Description

Description

 Cadlina laevis has a flattened, fragile oval body up to 3.2 cm in length. It is translucent white with opaque white or lemon-yellow pigmentation around the mantle edge. This species has distinctive white or lemon-yellow glands towards the mantle margin. The upper surface bears small conical, opaque white tubercules The underside is covered in a tracery of fine white markings. The front part of the foot (propodium) is groved to form two lips (bilaminate). Its white lamellate rhinophores are short and tapered, often with a yellow tip. The oral tentacles are short, broad and flattened. This species usually has 5 (rarely 6 or 7) tripinnate gills.Cadlina laevis was the first British nudibranch noted to reproduce by direct development (Thompson, 1967). Thompson (1967) observed that the embryonic period lasted for ca. 50 days with a vestigial veliger phase of 7 days occurring within the eggs. Tiny adults emerged from the eggs and remained benthic, having sufficient food reserves to sustain life and apparent growth for over a week before active feeding commenced (Thompson, 1967). Cadlina laevis feeds on encrusting sponges primarily Halisarca dujardiniand Dysidea fragilis. Interestingly, individuals of this species found in the north of the British Isles tend to have a milky white pigmentation and are mainly found in the littoral feeding on Halisarca dujardini. Individuals in the south and western parts of the British Isles have the distinctive lemon-yellow pigmentation and are mainly found feeding in the sublittoral on Dysidea fragilis (Picton & Morrow, 1994; Picton, 2001). It has been suggested that these two distinctive colour morphs may be separate species but the variation may be clinal due to its reproductive strategy (Picton & Morrow, 1994).  

This species spawns in March and its penis is armed with numerous tiny hooked chitinous spines. The tripinnate gills of this species retract simultaneously into a common branchial pit, a process known as cryptobranchiate (Thompson, 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This species is white or translucent white in colour, occasionally there is a yellow border around the edge of the mantle. The mantle tubercles are very short. One of the most characteristic features are the white or lemon-yellow glands situated towards the mantle margin. Mature specimens may reach 32mm in length.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Belgian Exclusive Economic Zone, British Isles, Canadian part of the Arctic Ocean, Cobscook Bay, Digby, European waters (ERMS scope), Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Saint Andrews, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cadlina laevis is reported by Colbeau (1868), Maitland (1897) and Jaeckel (1952).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic seas to Massachusetts; Europe
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cadlina laevis has a wide ranging distribution, it is known from eastern America, Greenland, Iceland and from Norway to Spain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 111 specimens in 1 taxon.
Water temperature and chemistry ranges based on 36 samples.

Environmental ranges
  Depth range (m): -1.5 - 141
  Temperature range (°C): 4.124 - 12.270
  Nitrate (umol/L): 0.584 - 11.666
  Salinity (PPS): 25.879 - 35.352
  Oxygen (ml/l): 4.518 - 7.199
  Phosphate (umol/l): 0.051 - 0.999
  Silicate (umol/l): 2.311 - 11.388

Graphical representation

Depth range (m): -1.5 - 141

Temperature range (°C): 4.124 - 12.270

Nitrate (umol/L): 0.584 - 11.666

Salinity (PPS): 25.879 - 35.352

Oxygen (ml/l): 4.518 - 7.199

Phosphate (umol/l): 0.051 - 0.999

Silicate (umol/l): 2.311 - 11.388
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Cadlina laevis is common among Lithothamnion covered rocks from the shore to the sublittoral. It can be found primarily on its prey, the sponges Halisarca dujardini and Dysidea fragilis.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on sponges such as Halisarca dujardini and perhaps Dysidea fragilis. Cadlina is one of the few British nudibranchs which have direct development, with tiny juvenile slugs hatching from the eggs rather than veliger larvae.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cadlina laevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTCGGAATGTGGTGTGGTTTACTCGGAACAGGACTTAGCTTATTAATTCGATTTGAATTAGGAACAGCTGGTGCGTTTCTAGGAGAT---GATCATTTTTATAATGTAATCGTGACCSCTCATGCATTTGTAATGATTTTTTTTATAGTAATACCTYTAATAATTGGAGGTTTTGGAAATTGGATAGTACCATTACTTATCGGGGCTCCTGATATAAGTTTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTTTTATCCTTTTATTATGTTCTACTCTTATAGAAGGAGGGGCTGGTACTGGATGAACTGTTTATCCTCCTTTATCAGGACCTGTGGCTCATGGAGGGGTCTCAGTAGATCTTGTTATTTTTTCTCTTCATCTTGCAGGGGCTTCTTCTCTTTTAGGGGCAATCAATTTTATTACGACTATTTTTAACATACGTTCCCCAGCTATAAGAATAGAACGTATTAGATTGTTTGTTTGATCAGTGTTAGTAACTGCTTTTTTATTATTACTGTCTCTTCCTGTATTGGCTGGGGCTATTACTATACTTCTTACTGATCGGAATTTTAATACTAGTTTTTTTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cadlina laevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cadlina laevis

Cadlina laevis, common name the white Atlantic cadlina, is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Cadlinidae.

Contents

Distribution

The white Atlantic cadlina is found, dispersed in widely separated populations, on rocky bottoms from the low tide zone to depths of 800 m, ranging from the Arctic to the North Atlantic (Canadian Arctic Archipelago, Spitsbergen, Iceland, Greenland). Along the North American coast its range reaches as far south as Massachusetts. It also occurs along the European coast from Norway to northern Spain. The reporting of a Cadlina with yellow markings near the Portuguese west coast could be an unnamed species of Cadlina.[1]

Description

They have a flattened, white, semitransparant, oval mantle. There appear to be two color varieties: one showing bright yellow spots near the thin, yellow margin on the back, the other is milky white and lacks spots.[2] There is also an intermediate form with milky yellow spots.[3] These forms do not seem to occur together: the yellow-spotted form lives in deeper water, whereas the other form lives intertidally.

The short, cephalic tentacles are comblike, and the short, tripinnate gills at the back are crytobranchiate, i.e. they can retract at the same time in a common branchial pit.

The observed length of these sea slugs varies between 25 mm[4] and 32 mm.[citation needed]

The maximum recorded length is 17 mm.[5]

Ecology

Minimum recorded depth is 0 m.[5] Maximum recorded depth is 250 m.[5]

This nudibranch preys on encrusting slime sponges, such as Halisarca dujardini or, in deeper waters, the sponge Dysidea fragilis. They are reported to breed at the end of winter. The penis of the male is encrusted with tiny chitinous hooks. They reproduce by direct development. When the eggs hatch after ca. fifty days, they give small slugs, forgoing the planktonic larval stage. The veliger phase occurs within the eggs.

References

  1. ^ "Cadline sp. from Portugal". Bill Rudman. 2005. http://www.seaslugforum.net/display.cfm?id=14712. Retrieved 2009-04-26.
  2. ^ "Cadlina laevis". The Sea Slug Forum. Bill Rudman. 2001. http://www.seaslugforum.net/display.cfm?id=4793. Retrieved 2009-04-26.
  3. ^ "Color varieties in Cadlina laevis". The Sea Slug Forum. Bill Rudman. 2001. http://www.seaslugforum.net/display.cfm?id=4784. Retrieved 2009-04-26.
  4. ^ Gofas, S. (2010). Cadlina laevis (Linnaeus, 1767). In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=139134 on 2010-12-26
  5. ^ a b c Welch J. J. (2010). "The "Island Rule" and Deep-Sea Gastropods: Re-Examining the Evidence". PLoS ONE 5(1): e8776. doi:10.1371/journal.pone.0008776.
  • Johnson R.F. (2011) Breaking family ties: taxon sampling and molecular phylogeny of chromodorid nudibranchs (Mollusca, Gastropoda). Zoologica Scripta 40(2): 137-157. page(s): 139

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!