Overview

Comprehensive Description

Description

 Acanthodoris pilosa is easy to distinguish from other nudibranch by its rounded, fluffy, soft-textured appearance. It has long, soft, pointed processes (papillae) all over its back, which are usually of a uniform length and colour. Colour is uniformly distributed and varies from white to brown and purplish-brown to charcoal grey. This sea slug usually grows up to 3 cm in length but may exceptionally reach 7 cm. Juveniles may have a speckled appearance. Two horn-like processes (rhinophores) at the front of the animal characteristically bend towards the rear and are much larger than the other processes (papillae). Up to 9 large gills form a circle at the rear of the animal.Feeds on encrusting bryozoans such as Alcyonidium hirsutum and Flustrellidra hispida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A. pilosa is easily distinguished from other British nudibranchs by its overall 'fluffy' appearance, caused by the presence of long, soft papillae all over the back of the animal. The rhinophores are long, with long shafts below the lamellate portions; the gills are large and fluffy. Colour is variable from white through brown and purple to black. Mature specimens of A. pilosa are usually 30mm in length but may reach almost 70mm. The large rhinophores and the long, soft papillae distinguish this species from any other British nudibranch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic, Beaufort Sea, Belgian Exclusive Economic Zone, Brier Island, British Isles, Canadian part of the Arctic Ocean, Cobscook Bay, De Haan, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Irish Exclusive economic Zone, North West Atlantic, Oostduinkerke, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, Wadden Sea, Wimereux, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bay of Fundy shore of Nova Scotia to Virginia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Seas to Ocean City, Maryland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Common all around the British Isles and from NE America to the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 61
  Temperature range (°C): 7.867 - 11.855
  Nitrate (umol/L): 4.066 - 7.251
  Salinity (PPS): 33.852 - 35.271
  Oxygen (ml/l): 5.743 - 6.234
  Phosphate (umol/l): 0.418 - 0.605
  Silicate (umol/l): 2.512 - 4.451

Graphical representation

Depth range (m): 0 - 61

Temperature range (°C): 7.867 - 11.855

Nitrate (umol/L): 4.066 - 7.251

Salinity (PPS): 33.852 - 35.271

Oxygen (ml/l): 5.743 - 6.234

Phosphate (umol/l): 0.418 - 0.605

Silicate (umol/l): 2.512 - 4.451
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Acanthodoris pilosa is often found on the shore but has also been recorded to depths of 80 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The prey of A. pilosa consists of encrusting bryozoans such as Alcyonidium hirsutum and Flustrellidra hispida on shore and the erect fleshy bryozoan Alcyonidium diaphanum in the sublittoral.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthodoris pilosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGATTATTAATTCGGTTTGAGCTTGGGACAGCGGGAGCTTTTTTAGGTKAT---GATCATTTTTATAATGTGATTGTAACTKCCCATGCTTTTGTAATAATTTTTTTTATGGTGATGCCTTTAATAATTGGAGGATTCGGAAATTGAATAGTTCCTTTATTAATTGGTGCACCTGACATAAGTTTTCCACGGATAAATAATATAAGGTTTTGGTTATTACCACCTTCTTTTATTCTGCTTTTATGTTCTACACTTATGGAAGGAGGGGCAGGAACAGGTTGAACTGTGTACCCACCCCTTTCAGGGCCGGTGGCACATGGGGGAGCATCTGTGGATTTAGCTATTTTTTCTCTACATTTAGCTGGGGCTTCTTCTTTACTTGGAGCAATTAATTTTATTACTACTATTTTTAATATACGATCTCCAGCGATAAGAATGGAACGTTTAAGACTATTTGTTTGATCTGTTTTAGTGACAGCCTTTCTTTTATTACTGTCATTGCCTGTACTTGCGGGGGCTATTACTATGCTTTTAACTGATCGGAATTTTWACACAAGATTCTTTGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthodoris pilosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthodoris pilosa

Acanthodoris pilosa is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Onchidorididae.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!