Overview
Comprehensive Description
Description
Acanthodoris pilosa is easy to distinguish from other nudibranch by its rounded, fluffy, soft-textured appearance. It has long, soft, pointed processes (papillae) all over its back, which are usually of a uniform length and colour. Colour is uniformly distributed and varies from white to brown and purplish-brown to charcoal grey. This sea slug usually grows up to 3 cm in length but may exceptionally reach 7 cm. Juveniles may have a speckled appearance. Two horn-like processes (rhinophores) at the front of the animal characteristically bend towards the rear and are much larger than the other processes (papillae). Up to 9 large gills form a circle at the rear of the animal.Feeds on encrusting bryozoans such as Alcyonidium hirsutum and Flustrellidra hispida.
Trusted
Description
A. pilosa is easily distinguished from other British nudibranchs by its overall 'fluffy' appearance, caused by the presence of long, soft papillae all over the back of the animal. The rhinophores are long, with long shafts below the lamellate portions; the gills are large and fluffy. Colour is variable from white through brown and purple to black. Mature specimens of A. pilosa are usually 30mm in length but may reach almost 70mm. The large rhinophores and the long, soft papillae distinguish this species from any other British nudibranch.
Trusted
Distribution
Atlantic, Beaufort Sea, Belgian Exclusive Economic Zone, Brier Island, British Isles, Canadian part of the Arctic Ocean, Cobscook Bay, De Haan, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Irish Exclusive economic Zone, North West Atlantic, Oostduinkerke, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, Wadden Sea, Wimereux, Zeeland
-
Leewis, R. (2002). Flora en fauna van de zee [Marine flora and fauna]. Veldgids, 16. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-153-X. 320 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1116
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
Trott, T.J. 2004. Cobscook Bay inventory: a historical checklist of marine invertebrates spanning 162 years. Northeastern Naturalist (Special Issue 2): 261 - 324.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=3072
-
Zintzen, V. (2007). Biodiversity of shipwrecks from the Southern Bight of the North Sea. PhD Thesis, University of Louvain, Department of Biology, 343 p.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=131973
-
d'Udekem d'Acoz, C. (1990). Notes on some organisms collected between Wenduine and De Haan on 3 March 1990 [Notes sur quelques organismes recueillis entre Wenduine et De Haan le 3 mars 1990]. De Strandvlo 10(3): 74-78
http://www.marinespecies.org/ophiuroidea/aphia.php?p=sourcedetails&id=138631
-
Simons, E.; Simons, G.; Corstanje, H. (1988). Report on the beach excursion at Oostduinkerke (Belgium) on 2 November 1988 [Verslag van de strandexcursie te Oostduinkerke op 2 november 1988]. De Strandvlo 8(4): 206-209
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=138809
-
Vanwalleghem, R. (1981). Observations on sea slugs [Waarnemingen in verband met naaktslakken]. De Strandvlo 1(2): 37-38
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=141441
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Miller, Roberta. 2011. The St. Anne de Bellevue Arctic Biological Station Collection In Museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=150285
-
Miller, Roberta. 2012. The museum collection database, Fisheries and Oceans Canada digital collections, Maurice Lamontagne Institute, Quebec
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=163928
Trusted
Bay of Fundy shore of Nova Scotia to Virginia
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Arctic Seas to Ocean City, Maryland
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Common all around the British Isles and from NE America to the Mediterranean.
Trusted
Ecology
Habitat
infralittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Known from rocky shores.
-
Natural Geography in Shore Areas (NaGISA) database, compiled by Ann Knowlton.
http://www.marinespecies.org/arms/aphia.php?p=sourcedetails&id=145467
Trusted
Depth range based on 75 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 61
Temperature range (°C): 7.867 - 11.855
Nitrate (umol/L): 4.066 - 7.251
Salinity (PPS): 33.852 - 35.271
Oxygen (ml/l): 5.743 - 6.234
Phosphate (umol/l): 0.418 - 0.605
Silicate (umol/l): 2.512 - 4.451
Graphical representation
Depth range (m): 0 - 61
Temperature range (°C): 7.867 - 11.855
Nitrate (umol/L): 4.066 - 7.251
Salinity (PPS): 33.852 - 35.271
Oxygen (ml/l): 5.743 - 6.234
Phosphate (umol/l): 0.418 - 0.605
Silicate (umol/l): 2.512 - 4.451
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 8 samples.
Environmental ranges
Depth range (m): 0 - 61
Temperature range (°C): 7.867 - 11.855
Nitrate (umol/L): 4.066 - 7.251
Salinity (PPS): 33.852 - 35.271
Oxygen (ml/l): 5.743 - 6.234
Phosphate (umol/l): 0.418 - 0.605
Silicate (umol/l): 2.512 - 4.451
Graphical representation
Depth range (m): 0 - 61
Temperature range (°C): 7.867 - 11.855
Nitrate (umol/L): 4.066 - 7.251
Salinity (PPS): 33.852 - 35.271
Oxygen (ml/l): 5.743 - 6.234
Phosphate (umol/l): 0.418 - 0.605
Silicate (umol/l): 2.512 - 4.451
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Acanthodoris pilosa is often found on the shore but has also been recorded to depths of 80 m.
Trusted
The prey of A. pilosa consists of encrusting bryozoans such as Alcyonidium hirsutum and Flustrellidra hispida on shore and the erect fleshy bryozoan Alcyonidium diaphanum in the sublittoral.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Acanthodoris pilosa
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ATTTTTGGTATATGATGTGGACTTTTAGGAACTGGATTAAGATTATTAATTCGGTTTGAGCTTGGGACAGCGGGAGCTTTTTTAGGTKAT---GATCATTTTTATAATGTGATTGTAACTKCCCATGCTTTTGTAATAATTTTTTTTATGGTGATGCCTTTAATAATTGGAGGATTCGGAAATTGAATAGTTCCTTTATTAATTGGTGCACCTGACATAAGTTTTCCACGGATAAATAATATAAGGTTTTGGTTATTACCACCTTCTTTTATTCTGCTTTTATGTTCTACACTTATGGAAGGAGGGGCAGGAACAGGTTGAACTGTGTACCCACCCCTTTCAGGGCCGGTGGCACATGGGGGAGCATCTGTGGATTTAGCTATTTTTTCTCTACATTTAGCTGGGGCTTCTTCTTTACTTGGAGCAATTAATTTTATTACTACTATTTTTAATATACGATCTCCAGCGATAAGAATGGAACGTTTAAGACTATTTGTTTGATCTGTTTTAGTGACAGCCTTTCTTTTATTACTGTCATTGCCTGTACTTGCGGGGGCTATTACTATGCTTTTAACTGATCGGAATTTTWACACAAGATTCTTTGAC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Acanthodoris pilosa
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 5
Species With Barcodes: 1
Trusted
Wikipedia
Acanthodoris pilosa
Acanthodoris pilosa is a species of sea slug, a dorid nudibranch, a shell-less marine gastropod mollusk in the family Onchidorididae.
References
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


