Table of Contents
Overview
Comprehensive Description
Brachidontes exustus is a member of the family Mytilidae. It has a thin, fan shaped shell with fine divercating radial ribs. The ribbed surface of the shell is most evident at the outer edges. Umbones are present at the extreme anterior end. The shell can range from blue-gray to yellow to dark brown. The interior has purple-brown blotches with one to four small purplish dysodont hinge teeth (Abbott and Morris 2001, Mekkelsen and Bieler 2008).Species designations in the genus Brachidontes are currently under revision (Berquist et al. 2006). A recent study of the Brachidontes exustus species complex in Florida suggests that there are four cryptic populations with distinct genetic profiles (Lee and O Foighil 2004).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Distribution
Gulf of Mexico
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
National Distribution
United States
Origin: Native
Regularity: Regularly occurring
Currently: Present
Confidence: Confident
Type of Residency: Year-round
© NatureServe
Source:
NatureServe
Trusted
Brachidontes exustus occurs in the intertidal on rock surfaces. The scorched mussel has been recorded from New Jersey to Florida, Bermuda, Bahamas, West Indies, Gulf of Mexico, Caribbean Central America, South America to Argerntina, and St. Helena (Mekkelsen and Bieler 2008). It is commonly found washed ashore in clusters attached to other shells and seaweeds. Brachidontes exustus is commonly associated with oyster reefs in the Indian River Lagoon.
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Physical Description
Size
The scorched mussel grows to 10 - 46 mm in length (Mekkelsen and Bieler 2008).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Ecology
Habitat
Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.
Environmental ranges
Depth range (m): 0.1 - 33
Temperature range (°C): 23.660 - 23.660
Nitrate (umol/L): 0.457 - 0.457
Salinity (PPS): 35.580 - 35.580
Oxygen (ml/l): 4.845 - 4.845
Phosphate (umol/l): 0.110 - 0.110
Silicate (umol/l): 0.868 - 0.868
Graphical representation
Depth range (m): 0.1 - 33
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 2 samples.
Environmental ranges
Depth range (m): 0.1 - 33
Temperature range (°C): 23.660 - 23.660
Nitrate (umol/L): 0.457 - 0.457
Salinity (PPS): 35.580 - 35.580
Oxygen (ml/l): 4.845 - 4.845
Phosphate (umol/l): 0.110 - 0.110
Silicate (umol/l): 0.868 - 0.868
Graphical representation
Depth range (m): 0.1 - 33
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Migration
Non-Migrant: No. All populations of this species make significant seasonal migrations.
Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Locally Migrant: No. No populations of this species make annual migrations of over 200 km.
© NatureServe
Source:
NatureServe
Trusted
Trophic Strategy
Brachidontes exustus are filter feeders (Riisg?rd 1988).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Population Biology
Brachidontes exustus is often the dominate mollusc in estuaries and mangrove roots (Barber et al. 2005).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Life History and Behavior
Reproduction
The scorched mussel is gonochronistic, having separate sexes. In a study of populations from Tampa Bay, Florida, the ratio of males to females is reported to be nearly 1:1. Brachidontes exustus has two spawning periods in the spring, between March and April and, in the fall, between September and November (Barber et al. 2005).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Growth
The embryology of the scorched mussel has not been well studied. However, other members in this family, such as Lithophaga bisulcata, Mytilus edulis, and Perna perna, have been well studied. The larvae of mytilid mussels appear to quickly develop into veligers followed by pediveligers (competent larvae) within a few weeks (Siddall 1980, Scott 1988a and b). Metamorphosis of the pedivleiger occurs once an appropriate area to settle is encountered (Siddall 1980, Scott 1988a).
- ITIS. Integrated Taxonomic Information System. Available online.
- Abbott RT and PA Morris. 2001. A Field Guide to Shells: Atlantic and Gulf Coasts and the West Indies pg. 17.American Museum of Natural History, Bivalves- Research, Training, and Electronic Dissemination of Data. Available online.
- Barber BJ, Fajans JS, Baker SM and P Baker. 2005. Gametogenesis in the non-native green mussel, Perna viridis, and the native scorched mussel, Branchiodontes exustus, in Tampa Bay, Florida. Journal of Shellfish Research 24:1087-1095.
- Berquist DC, Hale JA, Baker P and SM Baker. 2006. Development of ecosystem indicators for the Suwannee River estuary: oyster reef habitat quality along a salinity gradient. Estuaries and Coasts 29: 353-360.
- Lee T and D O Foighil. 2004. Hidden Floridian biodiversity: mitochondrial and nuclear gene tree reveal four cryptic species within the scorched mussel, Branchiodontes exustus, species complex. Marine Ecology 13:3527-3542.
- Mikkelsen PM and R Bieler. 2008. Seashells of Southern Florida. Princeton University Press, Princeton, NJ. pgs. 84-85.
- Riisg?rd HU. 1988. Efficiency of particle retention and filtration rate in 6 species of Northeast American bivalves. Marine Ecology Progress Series 45:217-223.
- Scott PJB. 1988a. Initial settlement behavior and survivorship of Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:97-108.
- Scott PJB. 1988b. Distribution, habitat and morphaology of the Caribbean coral- and rock-boring bivalve, Lithophaga bisculata (d'Orbigny) (Mytilidae:Lithophaginae). Journal of Molluscan Studies 54:83-95.Siddall SE. 1980. A classification of the genus Perna (Mytlidae). Bulletin of Marine Science 30:858-870.
© Smithsonian Marine Station at Fort Pierce
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Hormomya exustus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 94 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 94 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACACTTTATTTAGTTTTTGGTATTTGAAGTGGTTTGGCGGGAGTTGGCTATAGAATATTAATTCGTTTGCATTTGATACATCCTGGTAATTTCTTGTTGAAATCAGATAGTCTATACAACGTGATTGTGACTACACATGCTTTAGTTATAATTTTTTTCGCGGTAATGCCTTTACTTATTGGTGCTTTTGGTAACTGGCTTATTCCTTTAATAATTGGTGCTATAGACCTTGCTTTCCCGCGTGTTAATAATTTTAGTTTTTGAATTCTGCCTAGTGCCTTTTATTTATTATTATTATCAGGTTATGTGGAAGAAGGAGTAGGGACTGGTTGGACTATTTATCCTCCTTTATCTACTGTAGAATACCATAGAAGCCCTGCGATGGATCTTGCTATTTTATCACTTCGTTTAGCAGGTTCTGGGTCTTTAATAGGCGCTATTAATTTCTTAACCTCTAATAAAAATCTTCCTGTTAATAAAATAAAGGGAGAGCGATCTGTCCTGTATGTATGAAGAATCACGGTTACAGCCTTCTTGTTGCTGTTATCTTTACCGGTTTTAGCAGGAGCCATCACTATACTGTTGTTTGATCGTAATTTTAATACCACATTTTACGATCCAATCGGAGGAGGAGATCCTGTGTTATTTATACATCTTTTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Hormomya exustus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 94
Specimens with Barcodes: 94
Species With Barcodes: 1
Public Records: 94
Specimens with Barcodes: 94
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Genomic DNA is available from 2 specimens with morphological vouchers housed at British Antarctic Survey
© Ocean Genome Legacy
Source:
Ocean Genome Resource
Trusted
Conservation
Conservation Status
National NatureServe Conservation Status
United States
Rounded National Status Rank: N5 - Secure
© NatureServe
Source:
NatureServe
Trusted
NatureServe Conservation Status
Rounded Global Status Rank: G5 - Secure
Reasons: This is a common marine species (Abbott, 1958).
© NatureServe
Source:
NatureServe
Trusted
Wikipedia
Brachidontes exustus
Brachidontes exustus, or the scorched mussel, is a species of bivalve mollusc in the family Mytilidae. It can be found along the Atlantic coast of North America, ranging from Cape Hatteras to the West Indies and Brazil.[1]
References
- ^ Abbott, R.T. & Morris, P.A. A Field Guide to Shells: Altantic and Gulf Coasts and the West Indies. New York: Houghton Mifflin, 1995. 17.
 | This bivalve-related article is a stub. You can help Wikipedia by expanding it. |
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
