Articles on this page are available in 2 other languages: Dutch (2), Spanish (13) (learn more)

Overview

Brief Summary

Crassostrea gigas (most commonly known as the Pacific Oyster) is native to Japan, but has been introduced in many parts of the world for aquacultural and ecological purposes. Its shell is usually grey to purple and between 8-20 cm in length. Normally, the oyster is found in shallow waters at depths of around three meters and in temperatures ranging from 4-35°C. In its adult form, it is cemented to a hard substrate by one of its two valves. Individuals are usually male at first, but can change between sexes throughout their lifetime. The species is a filter-feeding, heterotrophic consumer, feeding mostly on bacteria, protozoa, various types of phytoplankton, larval forms of other invertebrates, detritus, and inorganic material.

C. gigas is used extensively by humans. It is cultured and harvested extensively for food. Also, it can be used to replace dying out organisms in an ecosystem. Introducing the species in vast quantities throughout the world has had a negative effect, however. C. gigas is now considered an invasive species. The aggressive manner in which it spreads can be very detrimental to an ecosystem.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The shell can grow up 18 cm long. An off-white to yellow or bluish grey in colour, the shell often has deep purple patches. The left valve is deeply cupped with 6 or 7 bold ribs making the shell margin rough. The right valve is flat or slightly convex and has ribs corresponding to channels of left valve.Similar to Crassostrea virginica although this species lacks the crenulate shell margin and bold ribs of Crassostrea gigas. Crassostrea gigas was introduced from Portugal to Essex in 1926 as a commercial crop and has since established itself in the wild. It occurs naturally in Japan and south-east Asia. Crassostrea gigas is also known as the Portuguese or Japanese oyster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology/Natural History: The shape of this oyster is quite variable. The species was introduced from Japan in the early 1900's (to Washington and British Columbia in 1922) and is the most important aquacultured species on the US West Coast. The japanese littleneck clam Tapes japonica and the Japanese oyster drill Ceratostoma inornatum, as well as the intestinal parasitic copepod Mytilicola orientalis were apparently introduced to our coast along with this species. May live 20 years or more. Often contains irregular, non-lustrous pearls. Predators include predatory oyster drill snails, the crabs Cancer magister, Cancer productus, Cancer oregonensis, Hemigrapsus nudus, and H. oregonensis, some sea stars, and the black oystercatcher (bird). The blue mud shrimp Upogebia pugettensis digs sediment from its burrows and smother the oysters with sediment. Attaches to hard substrates, such as the shells of other oysters. The oysters are imported as very small individuals (spat) and raised in commercial oyster beds. They are said to poorly reproduce in California, so are found only in the oyster beds. I have seen many oysters in apparently natural conditions here in Washington, so they must be able to reproduce at least a bit better here. Sexes are separate in this species, but an individual may change sexes in the winter and may alternate being male and female. A few are simultaneous hermaphrodites. They outgrow native oysters, probably partly because they are more efficient finter feeders, and can feed on nannoplankton, which native oysters cannot do. Occasionally they are influenced by a red tide (usually by the dinoflagellate Gonyaulax catanella) and become toxic to eat.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oysters have two thick, irregular valves, but one of them (the left) is usually cemented to the substrate (or to another oyster, as above). The valves are usually higher than long, have no "wings" near the hinge, and have no regularly spaced radial ribs. Crassostrea gigas grows up to 25 cm high and has conspicuous frills on its valves. Gray-white shell; often new growth is purplish-black. Inside is smooth and white. The left valve is usually larger and cupped, while the upper (right) valve is usually slightly smaller and flat.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Atlantic, Atlantic Europe, Baltic sea, Belgian Exclusive Economic Zone, Bizerte Lagoon, Black Sea, British Isles, Canadian Exclusive Economic Zone [Pacific part], Dutch Exclusive Economic Zone, Elbe, Europe, European waters (ERMS scope), FAO fishing area 67, German Bight, Greek Exclusive Economic Zone, Gulf of Gabès, Irish Exclusive economic Zone, Koksijde, Malta, Mediterranean Sea, New Zealand Exclusive Economic Zone, North Adriatic, North East Pacific, North Pacific, North Sea, Oosterschelde, Sas van Goes, Swedish Exclusive Economic Zone, United Kingdom, United Kingdom Exclusive Economic Zone, Wadden Sea, Zeebrugge, Zeeland
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Widely introduced on the west coast from Japan. Prince William Sound, AK to Newport Bay, CA. Very common in Willapa Bay, and in Departure Bay and the Georgia Strait in British Columbia.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Crassostrea gigas is native to the waters of the northwestern Pacific from the Sakhalin Islands to Pakistan. It has, however, been introduced in many areas of the world. On the west coast of North America, the species can be found from Prince William Sound, Alaska, to Newport Bay, California (Coan et al., 2000: 217). Several attempts have been made to introduce the species to Dutch and German waters, along with other coastal waters of Northern Europe. The species has also been observed in South Africa, Australia, New Zealand, France, and the British Isles (Nehring, 2006: 3,4).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Cannuel and Beninger (2006) demonstrated that the inner demibranchs of the gills develop earlier than the outer demibranchs. Plication of the gill is also attained relatively late in ontogeny. The gills of early juveniles of the species are thus structurally and functionally different from those of the adult.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Shell: The species has two solid valves. The left valve is slightly convex and the right valve is deep and cup-shaped. One valve is usually entirely cemented to the substrate by a small area. The species varies in shape. Normally it reaches lengths of 80-200mm, but large individuals can grow up to 450mm (Coan et al., 2000: 217; Nehring, 2006: 2).

Its shell is sculptured with radial ribs and concentric frills. The hard frills are frequently abraded, but in some habitats they are very prolonged. On hard substrates, the shell is rounded in shape with extensive fluting. On soft substrates, it is ovate and smooth. On mini-reefs, the margins of the shell are irregular. The color is grey to purplish on the outside. On the inside, it is white, generally with a light-colored adductor muscle scar (Coan et al., 2000: 217; Nehring, 2006: 2).

Soft body: The soft body of the organism can be divided into four sections: the visceral mass (containing most major organ systems), the adductor muscle (closes the shell), the gills, and the two asymmetric mantle lobes. The mantle lobes are partially connected to the visceral mass and were divided in three parts by Evseev and Yakovlev (1996: 240): thick, thin, and marginal mantle. The labial palps are of different sizes. They connect to the visceral mass and mantle. The portions of the palps facing each other are covered with ridges (Evseev and Yakovlev, 1996: 242). The organs of the visceral mass are described below:

Pericardial cavity – Includes two accessory hearts, located on the mantle lobes of the epibranchial chamber (Evseev and Yakovlev, 1996: 245).

Alimentary system - Includes the oesophagus, stomach, crystalline style sac, and intestine. The stomach is shaped like a “dumb-bell” (Evseev and Yakovlev, 1996: 245). Following the stomach is the intestine, which curves around the stomach and eventually ends in a simple anus (Evseev and Yakovlev, 1996: 250).

Interestingly, magnetic resonance imaging (MRI) has been used to examine the soft body of the organism in vivo (Pouvreau et al., 2006).

Embryo/Larva: Fertilized eggs are spherical, 45-62 µm in diameter. The egg is multilayered, with membranes that divide the jellylike outer coat from the small nucleus. The germinal vesicle is located within the nucleolus. Once a length of 125 µm is reached, the organism is considered an oyster larva. It develops an eyespot, along with a foot containing a byssal gland, which allows for attachment to the substrate (Pauley et al., 1988: 5).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Variable shell shape, sculpted with radial ribs and commarginal frills. Normally 80-200 mm in length, up to 450 mm. Shell is grey to purple on outside, white on inside, generally with a light-colored adductor muscle scar. Two solid valves; left valve is slightly convex, right valve is deep and cup-shaped (Coan et al., 2000: 217; Nehring, 2006: 2). Differs from Crassostrea virginica in that C. gigas never has a purple or black muscle scar. Differs from Ostrea lurida in that the inside shell of O. lurida is iridescent green. The shell of C. gigas is much larger and heavier than that of O. lurida (Pauley et al., 1988: 1,4).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

How to Distinguish from Similar Species: This is the largest local oyster; and usually the most commonly encountered one. The other introduced oyster (Crassostrea virginica) and the Olympic oyster (Ostrea lurida) do not have the conspicuous frills on the valves and grow to no larger than 15 cm high.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The species is similar to Crassostrea virginica, the difference being that C. gigas never has a purple or black muscle scar. It is also similar to Ostrea lurida. The separation here lies in the extremely large size and heavy shell of C. gigas. In addition, the inside of the shelll of O. lurida is iridescent green (Pauley et al., 1988: 1,4).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.762 - 6.5

Graphical representation

Depth range (m): 0.762 - 6.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found on the lower shore and shallow sublittoral to a depth of around 80 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Intertidal to 6m

Habitat: Firm sediment or rocky beaches

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Crassostrea gigas are found in the sheltered water of estuaries all over the world. They prefer intertidal and shallow subtidal zones that are about three meters deep (Nehring, 2006: 6). Specimens have been found, however, at depths of up to 40m (Minchin and Gollasch, 2008: 1). They are able to grow and reproduce in salinities of 10-42 psu with 23-36 psu being optimal. They are normally found in temperatures ranging from 4-35°C. Surviving individuals have been observed at -5°C, but in order for reproduction to occur, the water temperature must be at least 20°C (Nehring, 2006: 6). The oysters can tolerate a large pH range of 6-9.2. They are able to survive in water with oxygen levels as low as 2.9 µg/l (Minchin and Gollasch, 2008: 1).

The oysters attach to most hard surfaces found in suitable waters. While rocks are preferred, they can also be found in muddy or sandy areas. They frequently attach themselves to the shells of living or dead Crassostrea gigas, or other bivalve species. In areas of high reproductive success this results in solid reefs being formed (Nehring, 2006: 6). Strong waves can be very detrimental to a population (Pauley et al., 1988: 19).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Alien species

The Pacific cupped oyster Crassostrea gigas, seen by many people as a delicacy, was imported to Belgium in 1969 as an alternative to the failing farming of the local common oyster. It was originally thought that the species would not be able to reproduce here because of the cold climate. However, this proved to be incorrect. The Pacific cupped oyster is comfortable in Belgian waters and is able to attach itself to all kinds of hard substrates (dikes, groins, mussel banks…), while competing with mussels and other local shellfish for available space and food.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Adult Crassostrea gigas are completely sessile. The only time they are mobile is during their free-swimming larval stage. During this period, their primary means of dispersal is the water current (Pauley et al., 1988: 6). It has been hypothesized that, with water currents of 1 m/s, the larvae could spread up to 240 km, but no grown oysters have been observed that far from an established population. They are considered planktic larvae, but do have organs that allow for swimming. Eventually, they settle to the bottom of the water they float in, group together, and crawl around, searching for a suitable substrate (Nehring, 2006: 7). Larvae can be stimulated to settle by factors like temperature change, presence of suitable substrates, sufficient light, and surface irregularities of the substrate (Pauley et al., 1988: 17). The oysters have been known to attach themselves to the hulls of ships, thus achieving another means of dispersal (Nehring, 2006: 7).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Crassostrea gigas are filter-feeding, heterotrophic consumers. They are omnivores, feeding on bacteria, protozoa, various types of phytoplankton, larval forms of other invertebrates, detritus, and some inorganic material. The size of their food is usually between 2-10 µm (Pauley et al., 1988: 12).

When feeding, individuals secrete mucus to trap and sort food according to size. When larger food particles are encountered, more mucus is secreted. This occurs in the labial palps (thin, plate-like structures on either side of the mouth). The food is then either passed into the mouth or discharged. After taken through the mouth, it is sorted again by the caecum in the alimentary canal, and then digested (Pauley et al., 1988: 12).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

DMS in the odor landscape of the sea

Dimethyl Sulfide or DMS is present throughout the ocean(1). It’s an important odor component of many fish and shellfish, including clams, mussels, oysters, scallops, crabs and shrimp(2-9). Where does it come from? Usually from the marine plants they feed on.

Many species of plants and algae produce DMS, but not all species produce significant amounts of it. Nearly all of these are marine, and they tend to be in closely related groups with other DMS-producers, including Chlorophyte (green) seaweeds, the Dinophyceae in the dinoflagellates, and some members of the Chrysophyceae and the Bacillariophyceae (two classes of diatoms). Other large groups, like cyanobacteria and freshwater algae, tend not to produce DMS. (10,11)

Why do these groups produce DMS? In algae, most researchers believe a related chemical, DMSP, is used by the algae for osmoregulation- by ensuring the ion concentration inside their cells stays fairly close to the salinity in the seawater outside, they prevent osmotic shock. Otherwise, after a sudden exposure to fresh water (rain at the sea surface, for instance) cells could swell up and explode. In vascular plants, like marsh grasses and sugar cane, it’s not clear what DMS is used for. (12,13)

Freshly harvested shellfish can smell like DMS because DMSP has accumulated in their tissue from the algae in their diet. Some animals, including giant Tridacna clams and the intertidal flatworm Convoluta roscoffensis, harbor symbiotic algae in their tissues, which produce DMSP; this may not be important to their symbioses, but for Tridacna, the high DMS levels can be a problem for marketing the clams to human consumers. After death, DMSP begins to break down into DMS. A little DMS creates a pleasant flavor, but high concentrations offend the human palate.(2,14)

Not all grazers retain DMS in their tissues, though. At sea, DMS is released when zooplankton feed on algae. It’s been shown in the marine copepods Labidocera aestiva and Centropages hamatus feeding on the dinoflagellate Gymnodinium nelson that nearly all the DMS in the consumed algae is quickly released during feeding and digestion.(15) This has a disadvantage for the grazing zooplankton. Marine predators, like procellariiform seabirds, harbor seals, penguins, whale sharks, cod, and coral reef fishes like brown chromis, Creole wrasse and boga, can use the smell of DMS to locate zooplankton to feed on. (8,16,17)

It’s not easy to measure how much DMS is released from the Ocean into the air every year. Recent estimates suggest 13-37 Teragrams, or 1.3-3.7 billion kilograms. This accounts for about half the natural transport of Sulfur into the atmosphere, is the conveyor belt by which Sulfur cycles from the ocean back to land. In the atmosphere, DMS is oxidized into several compounds that serve as Cloud Condensation Nuclei (CCN). The presence of CCN in the air determines when and where clouds form, which affects not only the Water cycle, but the reflection of sunlight away from the Earth. This is why climate scientists believe DMS plays an important role in regulating the Earth’s climate. (12,18)

  • 1) BATES, T. S., J. D. Cline, R. H. Gammon, and S. R. Kelly-Hansen. 1987. Regional and seasonal variations in the flux of oceanic dimethylsulfide to the atmosphere. J. Geophys. Res.92: 2930- 2938
  • 2) Hill, RW, Dacey, JW and A Edward. 2000. Dimethylsulfoniopropionate in giant clams (Tridacnidae). The Biological Bulletin, 199(2):108-115
  • 3) Brooke, R.O., Mendelsohn, J.M., King, F.J. 1968. Significance of Dimethyl Sulfide to the Odor of Soft-Shell Clams. Journal of the Fisheries Research Board of Canada, 25:(11) 2453-2460
  • 4) Linder, M., Ackman, R.G. 2002. Volatile Compounds Recovered by Solid-Phase Microextraction from Fresh Adductor Muscle and Total Lipids of Sea Scallop (Placopecten magellanicus) from Georges Bank (Nova Scotia). Journal of Food Science, 67(6): 2032–2037
  • 5) Le Guen, S., Prost, C., Demaimay, M. 2000. Critical Comparison of Three Olfactometric Methods for the Identification of the Most Potent Odorants in Cooked Mussels (Mytilus edulis). J. Agric. Food Chem., 48(4): 1307–1314
  • 6) Piveteau, F., Le Guen, S., Gandemer, G., Baud, J.P., Prost, C., Demaimay, M. 2000. Aroma of Fresh Oysters Crassostrea gigas: Composition and Aroma Notes. J. Agric. Food Chem., 48(10): 4851–4857
  • 7) Tanchotikul, U., Hsieh, T.C.Y. 2006. Analysis of Volatile Flavor Components in Steamed Rangia Clam by Dynamic Headspace Sampling and Simultaneous Distillation and Extraction. Journal of Food Science, 56(2): 327–331
  • 8) Ellingsen, O.F., Doving, K.B. 1986. Chemical fractionation of shrimp extracts inducing bottom food search behavior in cod (Gadus morhua L.). J. Chem. Ecol., 12(1): 155-168
  • 9) Sarnoski, P.J., O’Keefe, S.F., Jahncke, M.L., Mallikarjunan, P., Flick, G. 2010. Analysis of crab meat volatiles as possible spoilage indicators for blue crab (Callinectes sapidus) meat by gas chromatography–mass spectrometry. Food Chemistry, 122(3):930–935
  • 10) Malin, G., Kirst, G.O. 1997. Algal Production of Dimethyl Sulfide and its Atmospheric Role. J. Phycol., 33:889-896
  • 11) Keller, M.D., Bellows, W.K., Guillard, R.L. 1989. Dimethyl Sulfide Production in Marine Phytoplankton. Biogenic Sulfur in the Environment. Chapter 11, pp 167–182. ACS Symposium Series, Vol. 393. ISBN13: 9780841216129eISBN: 9780841212442.
  • 12) Yoch, D.C. 2002. Dimethylsulfoniopropionate: Its Sources, Role in the Marine Food Web, and Biological Degradation to Dimethylsulfide. Appl Environ Microbiol., 68(12):5804–5815.
  • 13) Otte ML, Wilson G, Morris JT, Moran BM. 2004. Dimethylsulphoniopropionate (DMSP) and related compounds in higher plants. J Exp Bot., 55(404):1919-25
  • 14) Van Bergeijk, S.A., Stal, L.J. 2001. Dimethylsulfonopropionate and dimethylsulfide in the marine flatworm Convoluta roscoffensis and its algal symbiont. Marine Biology, 138:209-216
  • 15) Dacey , J.W.H. and Stuart G. Wakeham. 1986. Oceanic Dimethylsulfide: Production during Zooplankton Grazing on Phytoplankton. Science, 233( 4770):1314-1316
  • 16) Nevitt, G. A., Veit, R. R. & Kareiva, P. (1995) Dimethyl Sulphide as a Foraging Cue for Antarctic Procellariiform Seabirds. Nature 376, 680-682.
  • 17) Debose, J.L., Lema, S.C., & Nevitt, G.A. (2008). Dimethylsulfionoproprianate as a foraging cue for reef fishes. Science, 319, 1356.
  • 18) Charlson, R.J., Lovelock, J.E., Andraea, M.O., Warren, S.G. 1987. Oceanic phytoplankton, atmospheric sulphur, cloud albedo and climate. Nature, 326:655-661
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Jennifer Hammock

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators include: Japanese oyster drill Ocinebra japonica, predatory flatworm Pseudostylochus ostreophagus, Dungeness crab Cancer magister, rock crab C. productus, graceful crab C. gracilis, sun star Pycnopodia helianthoides, mottled star Evasterias troschelii, ochre star Pisaster ochraceus, pink star P. brevispinus.

Crabs and starfish pry the shells of the oyster open and consume the soft body on the inside. The Japanese oyster drill, a predatory snail, uses acid and a rough tongue to drill through the shell, then consumes the body (Pauley et al., 1988: 13,14).

Mytilicola orientalis is known to occur in the small intestine of C. gigas. It is a small bright red crustacean that can damage tissue in the oyster. Boring sponges (Cliona celata) and sea worms (Plydora ciliate) also can be found on the oysters. They can weaken the shell by boring holes in it (Pauley et al., 1988: 15).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Larval: In the free swimming larval stage, the animal develops a foot containing a byssal gland. This foot is extended when the larva is ready to settle. The foot attaches to any solid surface with which it comes into contact. When contact is made, the larva crawls onto the surface and, if it is suitable, attaches by the left valve (Pauley et al., 1988: 5,6).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Life History: Fertilized eggs develop into free-swimming larvae. After a period of growth, the larvae settle to the bottom, attach to a substrate, and develop into mature, sessile adult oysters. The oysters are usually males at first, but change between the sexes throughout their lifetime. When food is prevalent, they tend to be females, and when food is scarce they change into males. Hermaphrodites do occur on occasion. After one year, sexual maturity is reached (Nehring, 2006: 6; Pauley et al., 1988: 5-7).

Growth : Temperature radically affects the rate of development of the eggs. Most fertilized eggs develop to the shelled veliger stage within 48 hours. The resulting pelagic larvae grow over a period of 2 to 3 weeks. As the larvae grow, their length is 5-10 µm greater than their width. This condition persists until the larvae reach about 90 µm. At 100 µm, the length and the width are equal, but beyond 125 µm the width grows faster than the length. Growth of the free swimming larvae depends on many factors. The length of the larval period is dependent on the water temperature. Temperatures must be 20°C or greater for at least three weeks for optimal growth (Pauley et al., 1988: 5-7).

An eyespot, along with a foot containing a byssal gland, develops. Both remain throughout the free swimming stage. When the larvae reach a length of approximately 0.3 mm, their free swimming existence ends and they attach to the bottom or a hard substrate as spat. After the metamorphosis from free swimming larva to spat, the velum and foot disappear along with the anterior adductor muscle. The development of an enlarged set of gills begins. After settling, the juvenile oyster becomes a sessile animal (Pauley et al., 1988: 5-7).

Many factors affect the rate of growth in adults. They normally reach a length of 4-5 cm during their first year. Growth rate reduces significantly after 4 or 5 years. They exhibit compensatory growth, growing wider when lengthwise growth is physically deterred, and vice versa (Pauley et al., 1988: 5-7).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Individuals can live for up to 40 years (Pauley et al., 1988: 7).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

When water temperature reaches about 20°C and salinity levels are between 20-35 psu, synchronized spawning occurs. Sperm and egg are released at the same time through mutual stimulation and external fertilization occurs in the water (Minchin and Gollasch, 2008: 1; Pauley et al., 1988: 5). Females can release tens to hundreds of millions of eggs each year. Low success rates of these eggs are compensated by the long lifespan of the oysters (Padilla, 2010). Fertilization takes place within 10-15 hours of spawning (Nehring, 2006: 6).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

The organism’s family, Ostreidae, has been present since the Triassic. Currently the family contains 15 living genera and over 40 species (Mikkelsen and Bieler, 2007: 110).

Phylogenetic analysis for the genus Crassostrea is very difficult. This is partly because many of the phenotypic characteristics of the oysters are affected by the environment. However, through molecular analysis, Reece et al. (2008) suggest that Crassostrea sikamea (Kumomoto Oyster) is a very close relative of Crassostrea gigas. It was also suggested that Crassostrea angulata (Portuguese Oyster) and C. gigas might not actually be distinct species (Reece et al., 2008).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

The species is diploid, but triploidy occurs naturally in a low but constant frequency. Triploids are also able to be created in labs by blocking meiosis. This triploidy can result in organisms that are larger than their diploid counterparts. The triploid individuals can, at times, create viable progeny (Gong et al., 2004).

The genome of Crassostrea gigas has been investigated in detail, as demonstrated by more than 1700 entries on GenBank (NCBI, 2011). The entire mitochondrial genome has been sequenced (Ren et al., 2010), and patents have been issued. Apparently, the species is used in numerous research projects. For example, possible tumor-reducing agents found in the oysters are being investigated (Wang et al., 2010).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Crassostrea gigas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGATCTCACCAGGAATTAAAGTTTTTTTTAAAAGGTTCGCTCCTTTAAAAGTGTTTTTCCCTTGTCCAGTTCTTCTTTTTGAAAAGCGGGGGACATTTATGTCAACAAATCATTTAGACATTGGAAGGTTTTATATAGTATTTGGATTTTGAGCTGTTCTTGCGGGAACTAGGTTTAGGTCTCTTATTCGTTGGAGACTCTATAACCCTGGAGCTAAGTTTTTAGATCCCGTGACTTATAATGCAGTTGTAACTAGGCATGCGTTGGTTATGATTTTTTTCTTTGTTATACCTGTAATAATTGGGGGGTTTGGTAACTGGCTTATCCCTTTGATGCTTCTAGTAGCAGACATGCAATTTCCTCGATTAAATGCATTTAGATTTTGAGTTTTGCCAGGGTCTCTTTATCTTATGCTTATGTCTAACATTGTAGAAAACGGAGTTGGGGCAGGGTGAACAATTTACCCTCCTTTATCAACTTACTCTTATCATGGAGTTTGTATAGACCTTGCAATTCTAAGCCTTCACCTTGCTGGTATTAGCTCTATTTTCAGGTCAATTAATTTCATAGTAACGATTAGAAATATGCGATCTGTTGGGGGCCATTTACTAGCACTATTCCCTTGATCTATTAAGGTTACTTCATTCTTGCTTTTGACTACTCTCCCAGTGTTAGCTGGAGGTCTTACTATACTTTTGACTGATCGTCATTTTAATACCTCTTTTTTTGACCCTGTCGGAGGAGGGGACCCTGTCTTATTTCAGCATTTGTTTTGATTTTTTGGTCACCCTGAGGTGTATGTCCTTATTCTTCCAGGTTTTGGAATAATTTCTCATGTCTTATGTTTTTGGTCAAGTAAAAAGACTGCATATGGAAATATGGGAATGTTTTATGCAATACTTAATATTGGGTTCTTAGGGTTTATTGTCTGGGGGCATCACATGTTTGTGGCTGGAATGGATATTGATACGCGTGCTTATTTTAGTGCTGCCACCGTTATTATTGCAGTGCCAACTGGTATTAAGGTGTTTGCATGAATTAGCACAATGCTAGGCTCTAAAGTTTCAACTCAAGCACCTATGTTGTGGTCTACTGGTTTTATTATTCTTTTTACAACAGGGGGTCTTACAGGACTTATTCTATCAAGAGCTTCAGTAGATGTGACGCTTCACGACACTTATTTTGTAACTGGTCATTTTCACTACGTCTTATCAATGGGTGCGGTGTTTACAATTTTAGCTGGGTTTACTCACTGATTTCCTCTTGTTGCTAAGGTTATAATGCATCGGCAAAAAATGAAAAGTCATTTTTTAGCAATGTTTTTAGGTGTTAATGCAGCATTTTTGCCACATCATTTTTTGGGTTTGGCTGGTATACCACGTCGAGTAGTTGATTATCCAGATCATTTTTGATTTTGAAATAAAGTGTCCACATTTGGCTCTCATTTGAGTACTGGCTCATTGTTATTTTTTGTGTTTTTGTTATGAGAGTCATTTATTGCTCAACGGCCAGTTATTTCAGTGCGAAACACTTCTAGGTCCCCCGAATGGGCTGTTGTGTCTAGCCTCCCTAAGCATGCAGGGGATGAATTAGCAAAAATGGCTAAGCTTTGTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Crassostrea gigas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 151
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Crassostrea gigas is considered an invasive species. Conservation is not a concern. See the “Uses” section for information on the function of C. gigas as a replacement species in ecosystems in which conservation is an issue.

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The species is extensively commercially fished and grown in the aquaculture industry because of its large size, marketability, and ease of production (Pauley et al., 1988: 8). It has been introduced in foreign waters as a replacement for collapsed fisheries in the past. These introductions have had a negative effect though. C. gigas is now considered a major invasive species across the globe. By blanketing hard substrates, the species can overgrow the native species of sessile invertebrates, algae, and even some mussels (Padilla, 2010). Eutrophication (excess addition of nutrients) and habitat destruction have been seen in places invaded by the oyster (Nehring, 2006: 7).

Public Domain

Field Museum of Natural History

Source: Field Museum phylogenetics class

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pacific oyster

The Pacific oyster, Japanese oyster or Miyagi oyster (Crassostrea gigas), is an oyster native to the Pacific coast of Asia. It has become an introduced species in North America, Australia, Europe, and New Zealand.

Contents

Etymology [edit]

The species name comes from the Greek crass meaning "thick",[1] ostrea meaning "oyster" [2] and gígās meaning "giant".[3]

Description [edit]

The shell of Crassostrea gigas varies widely with the environment where it is attached. Its large, rounded, radial folds are often extremely rough and sharp. The two valves of the shell are slightly different in size and shape, the right valve being moderately concave. Shell colour is variable, usually pale white or off-white. Mature specimens can vary from 80 mm to 400 mm long.

Ecology [edit]

Habitat [edit]

Crassostrea gigas is an estuarine species, but can also be found in intertidal and subtidal zones. They prefer to attach to hard or rocky surfaces in shallow or sheltered waters up to 40 m deep, but have been known to attach to muddy or sandy areas when the preferred habitat is scarce. The Pacific oyster can also be found on the shells of other animals. Larvae often settle on the shell of adults, and great masses of oysters can grow together to form oyster reefs. The optimum salinity for Pacific oysters is between 20 and 25 parts per thousand (ppt), and they can tolerant salinities as high as 35 ppt; at this level, however, reproduction is unlikely to occur.[4] The Pacific oyster is also a very temperature tolerant species, as it can withstand a range from -1.8 to 35°C.[4]

Biology [edit]

Sexuality [edit]

The Pacific oyster has separate sexes, but hermaphrodites sometimes do exist.[5] Their sex can be determined by examining the gonads, and it can change from year to year, normally during the winter months.[5] In certain environmental conditions, one sex is favoured over the other.[5] Protandry is favoured in areas of high food abundance and protogyny occurs in areas of low food abundance.[5] In habitats with a high food supply, the sex ratio in the adult population tends to favour females, and areas with low food abundances tend to have a larger proportion of male adults.[5]

Spawning [edit]

Spawning in the Pacific oyster occurs at 20°C.[5] This species is very fecund, with females releasing about 50-200 million eggs in regular intervals (with a rate at 5-10 times a minute) in a single spawning.[5] Once released from the gonads, the eggs move through the suprabranchial chambers (gills), are then pushed through the gill ostia into the mantle chamber, and finally are released in the water, forming a small cloud.[5] In males, the sperm is released at the opposite end of the oyster, along with the normal exhalent stream of water.[5] A rise in water temperature is thought to be the main cue in the initiation of spawning, as the onset of higher water temperatures in the summer results in earlier spawning in the Pacific oyster.[6]

Life cycle [edit]

The larvae of the Pacific oyster are planktotrophic, and are about 70 µm at the prodissoconch 1 stage.[4] The larvae move through the water column via the use of a larval foot to find suitable settlement locations.[4] They can spend several weeks at this phase, which is dependent on water temperature, salinity and food supply.[4] Over these weeks, larvae can disperse great distances by water currents before they metamorphose and settle as small spat.[4] Similar to other oyster species, once a Pacific oyster larva finds a suitable habitat, it attaches to it permanently using cement secreted from a gland in its foot.[4] After settlement, the larva metamorphoses into a juvenile spat.[4] The growth rate is very rapid in optimum environmental conditions, and market size can be achieved in 18 to 30 months.[4] Unharvested Pacific oysters can live up to 30 years.

Aquaculture [edit]

Pacific oysters prepared for culinary purposes

Historical background [edit]

Crassostrea gigas was named by a Swedish naturalist, Carl Peter Thunberg in 1795.[4] It originated from Japan, where it has been cultured for hundreds of years.[4] It is now the most widely farmed and commercially important oyster in the world, as it is very easy to grow, environmentally tolerant and is easily spread from one area to another.[4] The most significant introductions were to the Pacific Coast of the United States in the 1920s and to France in 1966.[4] In most places, the Pacific oyster was introduced to replace the native oyster stocks which were seriously dwindling due to overfishing or disease.[4] In addition, this species was introduced to create an industry that was previously not available at all in that area.[4] As well as intentional introductions, the Pacific oyster has spread through accidental introductions either through larvae in ballast water or on the hulls of ships.[4] In some places in the world, though, it is considered by some to be an invasive species, where it is outcompeting native species, such as the Olympia oyster in Puget Sound, Washington, the rock oyster, Saccostrea commercialis in the North Island of New Zealand and the blue mussel, Mytilus edulis, in the Wadden Sea.

Production techniques [edit]

Numerous methods are used in the production of Pacific oysters. These techniques depend on factors such as the seed supply resources, the environmental conditions in the region and the market product, i.e., whether the oysters are sold in a half shell, or shelled for meat extraction.[4] Production can either be entirely sea-based or rely on hatcheries for seed supply.[4]

Seed supply [edit]

Most of the global Pacific oyster spat supply comes from the wild, but some is now produced by hatchery methods.[4] The seed from the wild can either be collected by the removal of seaweed from beaches or by hanging shell (cultch in suspension from long lines in the open water.[4] The movement towards hatchery-reared spat is important, as wild seed is susceptible to changeable environmental conditions, such as toxic algal blooms, which can halt the supply of seed from that region. In addition, several pests have been noted as considerable dangers to oyster seed.[5] The Japanese oyster drill (Ocenebra japonica), flatworm (Pseudostylochus osterophagus), and parasitic copepod (Mytlilcola orientalis) have been introduced accidentally to aquaculture areas, and have had serious impacts on oyster production, particularly in British Columbia and Europe.[5]

Broodstock [edit]

Pacific oyster broodstock in hatcheries are kept in optimum conditions so the production of large amounts of high quality eggs and sperm can be achieved.[4] Pacific oyster females are very fecund, and individuals of 70-100g live weight can produce 50-80 million eggs in a single spawn.[4] Broodstock adults are held in tanks at 20-22°C, supplied with cultured algae and with salinities of 25-32 ppt.[4] These individuals can be induced to spawn by thermal shock treatment.[4] Yet, it is more common for the eggs from a small sample of females (about six) to be stripped from the gonads using Pasteur pipettes and fertilized by sperm from a similar number of males.[4]

Larval and postlarval culture [edit]

Pacific oysters have a pelagic veliger larval stage which lasts from 14–18 days.[4] In the hatcheries, they are kept at temperatures of 25-28°C with an optimum salinity between 20 and 25‰.[4] Early-stage veligers (<120 nm shell length) are fed daily with flagellate algae species (Isochrysis galbana or Pavlova lutherii) along with diatom species (either Chaetoceros calcitrans or Thalassiosira pseudonana).[4] The larvae are close to a settlement stage when dark eye spots and a foot develop.[4] During this time, settlement materials (cultch), such as roughed PVC sheets, fluted PVC pipes, or shells, are placed into the tanks to encourage the larvae to attach and settle.[4] It is common, however, particularly on the US West Coast, for the mature larvae to be packed and shipped to oyster farms, where the farmers set the oysters themselves.[4]

Nursery [edit]

Pacific oyster spat can be grown in nurseries by sea-based or land-based upwelling systems. Nursery culture reduces mortality in small spat, thus increasing the farm’s efficiency.[4] Sea-based nursery systems are often located in estuarine areas where the spat are mounted on barges or rafts.[4] Land-based nursery systems have spat mounted on barges in large saltwater tanks, which either have a natural algae supply or are enriched with nutrients from fertilizers.[4]

Ongrowing techniques [edit]

This stage of oyster culture is almost completely sea-based.[4] A range of bottom, off-bottom, suspended and floating cultures are used.[4] The technique used depends on site-specific conditions, such as tidal range, shelter, water depth, current flow and nature of substratum.[4] Pacific oysters take 18– 30 months to develop to the market size of 70-100 g live weight (shell on). Growth from spat to adults in this species is very rapid at temperatures of 15-25°C and at salinities of 25 to 32 ppt.[4]

General production [edit]

In 2000, the Pacific oyster accounted for 98% of the world’s cultured oyster production, and is produced in countries all over the world.[7]

Production statistics [edit]

Global production has increased from about 150 tonnes in 1950 to 750 tonnes in 1980.[8] By 2003, global production had increased to 4.38 million tonnes.[8] The majority was in China, which produced 84% of the global production.[8] Japan, France and the Republic of Korea also contributed, producing 261 000, 238 000 and 115 000 tonnes produce, respectively.[8] The other two major producers are the United States (43 000 tonnes) and Taiwan (23 000 tonnes).[8] In 2003, global Pacific oyster production was worth $ 3.69 billion, with Asia contributing over half of this amount.[8]

Global aquaculture production of Crassostrea gigas

Current issues [edit]

Virus management [edit]

Pacific oysters are nonspecific filter feeders, which means they ingest any particulate matter in the water column.[9] This presents major issues for virus management of open water shellfish farms, as shellfish like the Pacific oyster have been found to contain norovirus strains which can be harmful to humans.[9] Globally, noroviruses are the most common cause of nonbacterial gastroenteritis, and are introduced into the water column by faecal matter, either from sewage discharge or land runoff from nearby farmland.[9] Numerous gastroenteritis outbreaks in the world have been directly caused by the consumption of shellfish from polluted areas.[10]

Heavy metal pollution [edit]

Pacific oysters, like other shellfish, are able to remove heavy metals, such as zinc and copper, as well as biotoxins (microscopic toxic phytoplankton), from the surrounding water.[5] These can accumulate in the tissues of the animal and leave it unharmed (bioaccumulation).[5] However, when the concentrations of the metals or biotoxins are high enough, shellfish poisoning can result when they are consumed by humans. High copper concentration in Pacific oyster can be recognised by the meat turning a grass-green colour.[5] Most countries have strict water regulations and legislation to minimise the occurrence of such poisoning cases.[11][12][13]

Diseases [edit]

DiseaseAgentTypeMeasures
Denman Island diseaseMikrocytos mackiniProtozoan parasiteRestricted modified culture practices
NocardiosisNorcardia crassoteaeBacteriumModified culture practices
Oyster velar virus disease (OVVD)UnknownVirusNone known
Herpes-type virus disease of C.gigas larvaeUnknownVirusNone

[8]

Predators [edit]

Numerous predators are known to damage Pacific oyster stocks.[14] Several crab species (Metacarcinus magister, Cancer productus, Metacarcinus gracilis), oyster drills and starfish species (Pisater ochraceus, P. brevispinus, Evasterias troschelii and Pycnopodia helianthoides) can cause severe impacts to oyster culture.[14]

Productivity [edit]

Productivity of the Pacific oyster can be discussed as the amount of meat produced in relation to the amount of seed planted on cultch.[5] The productivity of a farm also depends on the interaction of biotic factors, such as mortality, growth, and oyster size, as well as the quality of the seed and the growing technique used (off bottom, bottom, suspended or floating culture).[5] The main causes of mortality in the Pacific oystere are: natural mortality (age), predators, disease, environmental conditions (ice, freak winds), competition for space (crowding of cultch), silting (sediment runoff from land) and cluster separation (process of breaking up clusters of oysters to into as many individual oysters as possible).

Aquaculture in New Zealand [edit]

In New Zealand, the Pacific oyster was unintentionally introduced in 1950s, most likely through ballast water and from the hulls of ships.[15] Aquaculture farmers at the time noticed the Pacific oyster outcompeted the endemic species, the Sydney rock oyster (Saccostrea glomerata), which naturally occurs in intertidal areas in the North Island.[16] Early experiments in rock oyster cultivation procedures attached spat to cement-covered sticks and laid them down in racks.[16] The farmers noticed, however, the Pacific oyster outgrew the endemic species in most areas, and constantly was attaching to the rock oyster collection sticks. A few years later, Pacific oysters were the dominant species in the farms, as it grew three times faster than the rock oyster, produced a reliable and constant supply of spat, and had an already established market overseas. In 1977, the Pacific oyster was accidentally introduced to the Marlborough Sounds, and farming began there in the 1990s. Marlborough farmers developed a different method of cultivation in comparison to the North Island method of racks; they instead suspended their oysters on longlines.

Production status [edit]

The Pacific oyster is one of the three main aquaculture species in New Zealand along with king salmon and the greenshell mussels.[17] Pacific oyster aquaculture production has grown from an export value of $11 million in 1986 to $32 million in 2006.[17] In 2006, the 23 Pacific oyster farms throughout New Zealand covered a total of 750 hectares of marine space and produced 2,800 tonnes of product per year.[15] Annual production is now between about 3,300 and 4,000 tonnes.[16] In 2005, the value of New Zealand's Pacific oyster production was $12 million domestically, and $16.9 million for export.[18] New Zealand’s main export markets are Japan, Korea, the US, the EU and Australia.[18]

References [edit]

  1. ^ Definition of crass at dictionary.com.
  2. ^ Definition of ostrea at dictionary.com.
  3. ^ Definition of giga at dictionary.com.
  4. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj ak al Pacific Oyster factsheet, Food and Agriculture Organization of the United Nations (FAO)
  5. ^ a b c d e f g h i j k l m n o p Quayle, D.B (1969). Pacific oyster culture in British Columbia, p. 23. First Edition. Ottawa: The Queen’s Printer.
  6. ^ Grangeré K. et al. 2009. Modelling the influence of environmental factors on the physiological status of the Pacific oyster Crassostrea gigas in an estuarine embayment; The Baie des Veys (France). Journal of Sea Research, 62: 147–158
  7. ^ [1], Australian Aquaculture Portal
  8. ^ a b c d e f g The State of World Fisheries and Aquaculture (SOFIA)
  9. ^ a b c Greening, G.E., and McCoubrey D.J. 2010. Enteric Viruses and Management of Shellfish Production in New Zealand. Food Environ Virology, 2:167–175
  10. ^ [2] Arnold T. 2009.,Toxicity, Shellfish. Medical Director of Louisiana Poison Control Centre
  11. ^ [3] Scottish water quality regulations
  12. ^ [4] Irish water quality regulations
  13. ^ [5] American water quality regulations
  14. ^ a b [6] Nonindigenous aquatic species of concern for Alaska: Pacific oyster fact sheet
  15. ^ a b [7] Aquaculture.govt.nz
  16. ^ a b c [8] TeAra: The encyclopaedia of New Zealand
  17. ^ a b [9] Aquaculture.govt.nz: farmed species.
  18. ^ a b [10] New Zealand Government, Blue Horizon document
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Portuguese oyster

The Portuguese oyster, Crassostrea angulata, is a species of oyster found in the southwest Iberian Peninsula, closely related to the Pacific oyster. Although first identified as a native European species, genetic studies have suggested that the Portuguese oyster originated from the Pacific coast of Asia and was introduced to Europe by Portuguese trading ships in the 16th century. The species is usually found in coastal river mouths and estuaries.

Commercial Value

Prior to decimation by iridoviral disease in 1969, C.angulata was extensively cultivated in France and Portugal as part of the edible oyster industry. The Pacific oyster, which is more resistant to the disease, was introduced in the 1970s and have since replaced C. angulata as the main commercial species. Currently, the Portuguese oyster is not cultured commercially.

References

  • [1], Lapegue S, et al. 2004. Evidence for the presence of the Portuguese oyster, Crassostrea angulata, in northern China. Journal of Shellfisheries Research.
  • [2], Michinina S and Rebordinos L. 1997. Genetic differentiation in marine and estuarine natural populations of Crassostrea angulata. Marine Ecology Progress Series.
  • [3], Boudry P et al. 1998. Differentiation between populations of the Portuguese oyster, Crassostrea angulata (Lamark) and the Pacific oyster, Crassostrea gigas (Thunberg), revealed by mtDNA RFLP analysis. Journal of Experimental Marine Biology and Ecology.
  • [4], Gill Disease of Portuguese oysters. Fisheries and Oceans Canada.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!