Overview

Brief Summary

Introduction

The European squid is the type species of the genus Loligo. Maximum mantle length is about 42 cm in males, 32 cm in females; maximum weight 1.5 kg.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Very similar to Loligo forbesii but distinguished immediately by the tentacle club, the median suckers of which are especially large, up to four times diameter of marginal suckers. Loligo vulgaris can be up to 54 cm in length and has a small shield-like part of the body projecting slightly over the head. The internal shell is horny and pen-like. The colour varies and is often pink to white with purple brown mottling dorsally.Also commonly known as the European squid.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Remarks

Loligo reynaudi has previously been proposed to be a subspecies of L. vulgaris.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and biology

Ranging in depth from the surface to approximately 500 m, and most abundant between 20 and 250 m; deepest in winter. European squid is known to migrate vertically and horizontally in response to changes in environmental conditions. The stock in the northeastern Atlantic overwinters in deeper waters off Portugal, approaches the French coast in spring, and migrates from May through June farther north into the North Sea where spawning takes place in depths from 20 to 80 m. A southward migration takes place in fall. The stock on the west Saharan fishing grounds likewise overwinters in deeper offshore waters and migrates onshore for spawning in spring and fall. Accordingly, juveniles appear to recruit into the fishery in February and March and between July and September. In the western Mediterranean, European squid migrate into deeper water in late fall; the largest individuals begin their onshore migration as early as in January and February, followed in summer by the smaller ones.

Spawning extends for most of the year with peaks in early summer and early fall. Females produce up to 20000 small eggs (diameter about 2 mm) that are deposited in gelatinous tubes containing tens of eggs and attached to debris and other hard objects on sandy to muddy bottoms. The eggs hatch after an incubation period ranging between 25 days (at 22° C) and 45 days (at 12 to 14°C). The number (up to 800) and size of spermatophores is directly related to the size of the male. Males reproducing for the second time usually carry more than those reproducing for the first time.

Growth is faster in summer than in winter in both sexes; the rate is greater in males as compared with females. In the Atlantic, June hatchlings attain approximately 12 cm mantle length in December and 13 or 14 cm in the following April. By August, males reach about 17.5 cm and in April of their second year 21 cm, compared to 17 cm in females. In the western Mediterranean, juvenile females and males migrating onshore in July measure about 7 and 8 cm respectively (ranges 6.6 to 8 cm, and 7 to 8.3 cm) and grow to about 15 and 16 cm in December (ranges 14 to 16 cm and 15 to 17 cm). On the other hand, juveniles approaching the coast in October are approximately 5.7 cm long (range 5 to 6.3 cm) growing to 8.3 cm (range 7.8 to 8.9 cm) towards the end of December when they leave the shallow waters. By March they have attained a length of 13 cm. After May they mix with the other group in a new onshore migration to where spawning occurs.

Longevity is 2 years in females and about 3 years in males.

European squid feed on fishes and crustaceans. Cannibalism is common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle long, moderately slender, cylindrical.
  2. Fins
    1. Fins rhomboid, their length two thirds of mantle length, posterior border slightly concave.
  3. Arms:
    1. arm sucker rings with 20 teeth, distal teeth large and pointed, proximal teeth minute or absent.
    2. Left ventral arm hectocotylized along its distal 1/3 - 2/4 by modification of suckers into papillae that decrease in size distally
  4. Tentacles
    1. Manus of tentacular clubs with 4 longitudinal series of suckers, 2 median series with 6 enlarged suckers each.
    2. sucker rings of median series on manus with approximately 30 irregularly-sized teeth; club with about 36 transverse rows of minute suckers.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Angola, Belgian Exclusive Economic Zone, British Isles, De Panne, Dutch Exclusive Economic Zone, East Atlantic, European waters (ERMS scope), Greek Exclusive Economic Zone, Halve Maan, Irish Sea, Mediterranean Sea, Moroccan Exclusive Economic Zone, Nice, Oostende, Oosterschelde, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Vlissingen, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical distribution

Eastern Atlantic: From approximately 20° S to 55°N; around the British Isles, North Sea; Mediterranean Sea.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

coastal to upper slope, semi-pelagic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 5597 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2319 samples.

Environmental ranges
  Depth range (m): 13 - 553
  Temperature range (°C): 6.695 - 20.525
  Nitrate (umol/L): 0.729 - 22.418
  Salinity (PPS): 33.707 - 38.781
  Oxygen (ml/l): 3.323 - 6.438
  Phosphate (umol/l): 0.094 - 1.900
  Silicate (umol/l): 1.837 - 18.030

Graphical representation

Depth range (m): 13 - 553

Temperature range (°C): 6.695 - 20.525

Nitrate (umol/L): 0.729 - 22.418

Salinity (PPS): 33.707 - 38.781

Oxygen (ml/l): 3.323 - 6.438

Phosphate (umol/l): 0.094 - 1.900

Silicate (umol/l): 1.837 - 18.030
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Has no preference for a particular bottom type, the only requirement seems to be the presence of substrata for the attachment of egg strings during the spawning period.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loligo vulgaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTCGGTATTTGAGCAGGGTTAGTTGGTACTTCATTAAGATTAATAATTCGAACAGAACTAGGTAAACCCGGTTCACTGTTAAATGAC---GATCAACTATACAATGTAGTAGTAACTGCTCACGGGTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGGGGATTCGGAAACTGATTAGTGCCTATAATACTAGGTGCGCCAGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTACTTCCCCCTTCGCTAACACTTTTATTAGCTTCATCTGCTGTAGAAAGAGGAGCTGGTACAGGATGAACAGTCTACCCCCCATTATCTAGAAATCTTTCTCACGCAGGACCGTCTGTAGATTTAGCCATTTTTTCACTCCATTTAGCTGGTATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATAAATATACGATGAGAAGGTTTATTAATAGAACGAATATCTCTATTCGTATGATCTGTGTTCATTACAGCAATTCTATTATTATTATCTCTTCCTGTTTTAGCTGGAGCAATTACGATACTTCTTACTGACCGAAACTTTAATACTACTTTTTTTGACCCCAGAGGWGGAGGAGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo vulgaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

European squid

The European squid (Loligo vulgaris) is a large squid belonging to the family Loliginidae. It occurs abundantly in coastal waters from the North Sea to at least the west coast of Africa. This species lives from sea level to depths of 500 m (1,600 ft). Its mantle is up to 40 cm (16 in) long. The species is extensively exploited by commercial fisheries.

Loligo reynaudii, the Cape Hope squid, was previously treated as a subspecies of L. vulgaris.[1]

Contents

Description

Illustration from 1913

The European squid has a long, moderately slender and cylindrical body, and rhomboid fins that comprise two-thirds of the mantle length. The posterior border is slightly concave. The head is relatively small and has large eyes which are covered with a transparent membrane. Like almost all squid, this species has ten limbs surrounding the mouth and beak: eight are relatively short arms, and two, which form the tentacles, are long, as they are used to catch prey. The fourth left arm of males is a hectocotylus. The European squid can grow up to 30–40 cm in the mantle length, but more usually they are 15–25 cm long. The males are generally bigger than the females and exhibit more rapid rates of growth.

The colour of the European squid is greyish-transparent or reddish, depending on the expansion of chromatophores in the dermis. Males have small chromatophores on their mantle.[2]

Habitat and distribution

The European squid is a neritic, semi-demersal species, which undertakes distinct horizontal and vertical migrations, depending on the environment. In the Adriatic Sea, European squid can be found above various substrates, from sandy through to the muddy bottoms.[2]

Loligo vulgaris is found throughout the Mediterranean and in the eastern Atlantic Ocean from the North Sea to the Gulf of Guinea. In British waters it is mainly found in the Irish Sea, along the south coast of England, and off northern Scotland.[3]

Biology

This species can be found at depths from the surface to approximately 500 m, but it is most abundant between 20 and 250 m (deeper during the winter months). The population in the northeastern Atlantic spends the winter in deeper waters off Portugal, then moves towards the coast of France in spring, before migrating farther north into the North Sea during May and June where they spawn in depths ranging from 20 to 80 m. A southward migration takes place in autumn. The population found off Morocco and Western Sahara similarly spends the winter months in deeper offshore waters and moves inshore to spawn in spring and autumn. The main juvenile recruitment is in February and March and between July and September. In the western Mediterranean, European squid move into deeper water in late autumn; the largest individuals commence their inshore migration as early as in January and February, while the smaller individuals wait until summer.

The spawning season extends for most of the year but climaxes in early summer and early autumn. Females lay up to 20,000 small eggs, which are deposited in gelatinous tubes containing tens of eggs each. These tubes are attached to debris and other solid objects on sandy to muddy bottoms. The incubation period is dependant on temperature and is between 25 days (at 22°C) and 45 days (at 12 to 14°C). The size of the male determines the number (up to 800) and size of spermatophores. Males that are reproducing for the second time usually carry more than those reproducing for the first time.

Growth in both sexes is temperature dependant and is therefore faster in summer than in winter; the males grow faster than females. In the Atlantic, young squid hatched in June reach a mantle length of around 12 cm by December and grow to 13 or 14 cm by the following April. By August, males attain a mantle length of 17.5 cm and, if they reach the following April, 21 cm, compared to 17 cm in females. Life expectancy is 2 years in females and about 3 years in males.[4]

European squid are predators on fishes and crustaceans. Cannibalism is common.[4]

Fisheries

The European squid is a commercially valuable species. It is caught in multispecies trawl fishing throughout the year and, seasonally, in small scale and recreational fishing with a variety of gear.

In the Adriatic Sea, the total annual catch of the species is around 1,000 to 1,500 tonnes. This is very variable and is probably linked to the annual reproduction cycle that is typical for many cephalopods.

References

  1. ^ Vecchione, M. & R.E. Young. (2010). Loligo reynaudii Orbigny 1845. Tree of Life Web Project.
  2. ^ a b Loligo vulgaris (Lamarck, 1798). AdriaMed.
  3. ^ Grid map of records on the Gateway for Loligo vulgaris. NBN Gateway.
  4. ^ a b Vecchione, M. & R.E. Young (2010). Loligo vulgaris Lamarck 1798. Tree of Life Web Project.
  • Vecchione, M., E. Shea, S. Bussarawit, F. Anderson, D. Alexeyev, C.-C. Lu, T. Okutani, M. Roeleveld, C. Chotiyaputta, C. Roper, E. Jorgensen & N. Sukramongkol. (2005). Systematics of Indo-West Pacific loliginids. PDF Phuket Marine Biological Center Research Bulletin 66: 23–26.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!