Overview

Distribution

All coasts, but uncommon in south, not present around Channel Islands
  • Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

60°N to 42°N; 70°W to 45°W, Nova Scotia to Cape Cod, Mass.; Gulf of St. Lawrence (unspecified region); southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), 8 to 2195 m (live 8 to 48 m)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

shelf to bathyal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 220 - 223

Graphical representation

Depth range (m): 220 - 223
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 860 specimens in 1 taxon.
Water temperature and chemistry ranges based on 616 samples.

Environmental ranges
  Depth range (m): 0 - 2335
  Temperature range (°C): -0.841 - 15.244
  Nitrate (umol/L): 3.319 - 24.470
  Salinity (PPS): 32.125 - 36.061
  Oxygen (ml/l): 3.424 - 6.971
  Phosphate (umol/l): 0.394 - 1.571
  Silicate (umol/l): 2.193 - 19.373

Graphical representation

Depth range (m): 0 - 2335

Temperature range (°C): -0.841 - 15.244

Nitrate (umol/L): 3.319 - 24.470

Salinity (PPS): 32.125 - 36.061

Oxygen (ml/l): 3.424 - 6.971

Phosphate (umol/l): 0.394 - 1.571

Silicate (umol/l): 2.193 - 19.373
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

feed on mainly foraminiferans
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antalis entalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCATAAAGATATTGGGACTTTATATTTTATTATTGGTATTTGATCAGGAATAGTTGGTACTGCTTTAAGACTATTAATTCGAACTGAATTAGGGCAACCTGGGAGCCTTTTAGGAGAT---GATCAACTTTATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTTTAGTAATACCTTTAATAATTGGGGGGTTTGGAAATTGACTAATTCCATTAATATTAGCTTCACCTGATATAGCTTTTCCTCGTATGAATAATCTAAGATTTTGACTTCTTCCTCCTTCTTTATTTCTTTTATTAGTTTCTACTATCATAGAGAGGGGAGCTGGAACAGGTTGAACTGTATATCCTCCTCTATCTGGAAATATTGCTCATAGGGGATCCTCTGTTGACTGGGTTATTTTCTCATTACATTTAGCAGGAGTTTCTTCTATTCTTGGTGCAGTTAATTTTATTAGAACAGTTATTAATATGCGGTCTAAAGGATTAATTTTAGAACGTATCCCTCTGTTTGTTTGATCTGTAAAAATTACTGCGATTCTTTTACTTCTTTCATTACCCGTTTTAGCCGGAGCCATTACAATATTATTAACTGATCGAAATTTTAATACGTCCTTTTTTGACCCAGCCGGGGGCGGAGATCCTATTTTATACCAACATCTATTTTGATTTTTTGGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antalis entalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!