Overview

Comprehensive Description

Description

Bathyteuthis abyssicola, Hoyle

 

 

Bathyteuthis abyssicola, Hoyle, Narr. Chall. Exp., vol. i. p. 272, fig. 108, 1885.

 

 

The Body is subcylindrical, somewhat narrowing towards and bluntly rounded at the posterior extremity. The fins are small, separate; each is somewhat rectangular in shape, with rounded angles, and attached to the body by one angle.

 

The mantle-margin is almost transverse, but projects slightly on the dorsal median line, and forms a shallow sinus behind each eye and the siphon. The mantle-connective consists of a long linear ridge, extending quite to the margin, and fitting into a similar but somewhat shorter and broader groove on the base of the siphon, which is short, tapering, and bluntly pointed, fits into a shallow depression below the head, but has no dorsal bridles.

 

The Head is much broader than the body, being distended laterally by the enormous eyes which look outwards and forwards, and have bright, prominent, glistening lenses.

 

The Arms are unequal, the order of length being 4, 3, 2, 1, and about one-fourth the length of the body: they are all conical and taper to slender points; each has a distinct angle along the outer side, which expands to a distinct web in the fourth pair; there is also a very narrow delicate web along each side of the sucker bearing face. The suckers are very minute, pedunculate, and are arranged in to rows, almost embedded in the arm: they are spheroidal, and have a smooth horny ring, surrounded by two or three rows of conical papillæ. The hectocotylus was not present. The buccal membrane is very large, has the usual seven points, connected by ligaments with the arms; each joint bears one or two suckers.

 

The Tentacles are almost equal in length to the head and body together; the stem is very slender, cylindrical, and grooved along the inner aspect; they taper way rapidly towards the extremity, no club being formed: the suckers cover on the distal eighth of the tentacle in its inner aspect: they are smaller than those of the sessile arms, and almost imperceptible to the naked eye; they are urn-shaped, and have a smooth horny ring, surrounded by about two rows of very small papillæ.

 

The Surface is covered with minute wrinkles, probably due to the action of the spirit.

 

The Colour is a very deep purplish brown.

 

The Gladius was unfortunately somewhat damaged; for the anterior two-thirds it resembles that of an Ommastrephes, but posteriorly it expands into a broad blade, resembling that of Loligo; it was impossible to ascertain whether it forms a terminal cone.

 

Hab. Southern Ocean (Station 147), 1600 fathoms. One specimen, sex?”

 

 

(Hoyle, 1885: 309-310)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© National Museum of Natural History, Smithsonian Institution

Source: Antarctic Invertebrates Website (NMNH)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species was originally described from specimens taken in the Indian Ocean section of Subantarctic waters between Crozet Island and Prince Edward Island. This species is cosmopolitan throughout the world's oceans. It is circumpolar in the Southern Ocean, and is also found in the highly productive waters of the eastern Pacific, the Atlantic, and the Indian Oceans (Roper 1969). It is bathypelagic and normally occurs at between 700-2,000 m. Records citing deeper depths are probably artefacts from open (non-closing) sampling nets, although it is known that paralarvae and juveniles are found in shallower depths. In the Southern Ocean and in the eastern tropical-subtropical North Atlantic, this species undertakes a diel vertical migration (Roper 1969, Clarke and Lu 1975, Lu and Clarke 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

cosmopolitan
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Syntype for Benthoteuthis megalops Verrill, 1885
Catalog Number: USNM 39968
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Isopropyl Alcohol
Year Collected: 1884
Locality: 150 Miles E. Of Coast., New Jersey, United States, North Atlantic Ocean
Depth (m): 1962 to 1962
Vessel: Albatross R/V
  • Syntype: Verrill, A. 1885. Trans. Conn. Acad. Arts Sci. 6(2): 402-403.; Verrill, A. E. 1885. Trans. Conn. Acad. Arts Sci. 6(2): 402-403, pl. 44.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Syntype for Benthoteuthis megalops Verrill, 1885
Catalog Number: USNM 39967
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: female;
Preparation: Isopropyl Alcohol
Year Collected: 1884
Locality: Off Coast, New Jersey, United States, North Atlantic Ocean
Depth (m): 1097 to 1097
Vessel: Albatross R/V
  • Syntype: Verrill, A. 1885. Trans. Conn. Acad. Arts Sci. 6(2): 402-403.; Verrill, A. E. 1885. Trans. Conn. Acad. Arts Sci. 6(2): 402-403, pl. 44.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Bathyteuthid squids are small (less than 8 cm mantle length) deep-sea animals. They tend to be dark red, have short arms and somewhat tubular eyes directed forward. Species of Bathyteuthis are found in lower mesopelagic to bathypelagic depth waters throughout much of the world’s oceans. They have large photosensitive vesicles just behind the eyes which appear to detect bioluminescence. These photosensitive vesicles are among the largest known in any cephalopod. See Roper (1998) for additional information.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

meso-bathypelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 303 specimens in 1 taxon.
Water temperature and chemistry ranges based on 298 samples.

Environmental ranges
  Depth range (m): 49 - 5014
  Temperature range (°C): -0.039 - 19.782
  Nitrate (umol/L): 0.535 - 40.698
  Salinity (PPS): 33.871 - 36.590
  Oxygen (ml/l): 0.364 - 7.698
  Phosphate (umol/l): 0.046 - 3.381
  Silicate (umol/l): 0.958 - 141.571

Graphical representation

Depth range (m): 49 - 5014

Temperature range (°C): -0.039 - 19.782

Nitrate (umol/L): 0.535 - 40.698

Salinity (PPS): 33.871 - 36.590

Oxygen (ml/l): 0.364 - 7.698

Phosphate (umol/l): 0.046 - 3.381

Silicate (umol/l): 0.958 - 141.571
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathyteuthis abyssicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGCGATGATTATTTTCTACAAACCACAAAGATATTGGAACACTTTACTTTATCTTTGGTATTTGAGCAGGATTACTAGGTACTTCTTTAAGATTAATAATCCGAACGGAATTAGGACAACCTGGTTCCTTACTAAATGATGATCAACTCTATAATGTAGTTGTTACTGCCCATGGATTTATTATAATTTTCTTTTTAGTAATACCAATTATAATTGGAGGATTTGGTAACTGATTAGTCCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGATTTTGATTGCTTCCTCCTTCATTAACTTTGCTTTTAGCTTCTTCAGCTGTAGAAAGAGGAGCAGGGACAGGCTGAACAGTATACCCTCCTTTATCTAGAAATTTATCCCACGCAGGACCTTCAGTAGACCTAGCCATTTTTTCCCTTCATCTAGCTGGAGTTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGATGAGAAGGGCTACAAATAGAACGACTACCCCTCTTTGCTTGATCAGTTTTTATTACTGCAATTCTACTACTACTTTCCCTTCCCGTTCTAGCTGGAGCAATTACTATGCTATTAACTGATCGAAACTTTAATACTACTTTTTTTGATCCTAGAGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGGCACCCAGAAGTTTATATTTTAATCCTTCCAGGATTTGGTATTATTTCCCATATTGTATCCCATCACTCATACAAAAAAGAAATTTTTGGAGTACTAGGAATAATCTATGCAATACTATCTATTGGGTTATTAGGCTTTATTGTATGAGCTCATCATATATTTACAGTTGGAATAGACGTAGATACACGAGCCTACTTCACATCAGCAACAATAATTATTGCAATTCCTACTGGTATTAAAGTATTTAGGTGGTTAGCTACAATTTATGGCTCACCTATTAAATATAATACCCCTATACTATGAGCCCTAGGATTTATCTTTTTATTTACAGTAGGAGGCTTAACAGGAATTATTTTATCAAACTCATCTTTAGATATTATACTTCATGATACTTATTATGTAGTTGCCCATTTCCATTACGTCTTATCTATAGGAGCCGTGTTTGCTTTATTTGGGGGATTTAACCATTGATACCCTTTAATTACAGGATTAAGATTAAACCAGCAATGAACTAAAGCCCATTTTATAACAATATTTTTAGGAGTTAATTTAACTTTTTTCCCTCAACATTTTTTAGGTTTAGCTGGAATACCTCGACGTTATTCAGACTACCCAGACTGCTACACTAAATGAAATATAATCTCATCAATAGGGTCCTTGATCTCCTTAACTAGAATTTTATTTTTCATTTTTATTGTTTGAGAAAGACTAATCTCTCAACGAACAGTTATTTGATCTAACCATTTAACAACCTCCTTAGAATGGGACAACCGTTTACCCGTTGATTTCCATAGACTACCCGAAACAGGAGCTCTTTATATTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bathyteuthis abyssicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
Allcock, L. & Barratt, I.

Reviewer/s
Vecchione, M., Young, R. & Böhm, M.

Contributor/s
Duncan, C.

Justification
Bathyteuthis abyssicola has a wide geographic distribution rendering it less susceptible to localized human impacts. It is currently not fished and is, in theory, also protected by part of its distribution overlapping a zone protected by the Antarctic Treaty System. It has therefore been assessed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size of this species is unknown.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are not known.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. However, part of the distribution of Bathyteuthis abyssicola falls within territory governed by the Antarctic Treaty System of which the Convention for the Conservation of Antarctic Marine Living Resources (CCAMLR) is a part. The objective of CCAMLR is to safeguard the environment and protect the integrity of the ecosystem of the seas surrounding Antarctica and to conserve Antarctic marine living resources. Further research into the distribution, abundance and ecology of this species is recommended.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bathyteuthis abyssicola

Bathyteuthis abyssicola, also known as the deepsea squid, is a species of squid in the family Bathyteuthidae.

Bathyteuthis abyssicola is the type species of Bathyteuthis. It is a small, deep maroon-colored squid that inhabits the meso- and bathypelagic zones of all oceans of the world, and is particularly abundant in the Southern Ocean where it seems to be the dominant small deep-sea squid. B. abyssicola normally occurs at depths from 700–2,000 m (2,300–6,600 ft), but has been recorded from 100–4,200 m (330–13,800 ft).

The arms of B. abyssicola are short, with blunt tips. Protective membranes are low, fleshy, without free trabeculae (beam- or finger-like protuberances). Suckers are relatively few in number, about 100 on each of the upper six arms (pairs I–III). Sucker rings on the arms have 8–18 separated, bluntly rounded to truncate protuberances. The tentacles and clubs are relatively short. Gills are short and narrow.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!