Overview

Comprehensive Description

Biology

This species varies from light to dark green to brown in color. Often there is a white patch behind the rhinophores and a white line from the patch running up the basal half of each rhinophores. The rhinophores have a white upper region and mottled green or brown lower half. The rhinophores are rolled and have prominent protrusions/papillae. These papillae are found on the body of the animal and are usually white in color.

Elysia tuca is one of the solar powered sacoglossans which keep the chloroplasts from their algal food alive and photosynthesizing to produce sugars and other nutrients for their own use.

This species lays egg masses with a thick, bright orange ribbon of extra-capsular yolk. This ribbon of yolk touches each developing embryo. There is virtually no intracapsular metamorphosis and swimming veligers hatch between 2 and 16 days, depending on where they are in the egg mas (Krug, 2009).


Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Body dark green with irregular iridescent white patches on parapodial margin and on head between rhinophores; parapodia smooth, held tightly rolled against midline of body, with distinct mid-length notch forming a ventilatory "chimney". Length to 15 mm."

"This species is easily separable from all other Caribbean species by the parapodial notch, coloration, diet, and posture. Verrill's description notes the distinctive white patch between the rhinophores, but erroneously identified the species as Tridachia crispata. This has led to some confusion that Tridachia crispata occurs in Bermuda; it apparently does not. This also explains why E. tuca, which is ubiquitous throughout the Caribbean, has not been previously reported from Bermuda." (Clark, 1984 Nautilus 98(2), p. 90)

"On the back of the head there is a white cross-shaped figure, on the neck a white triangle. The edges of the parapodia are white or beige, there is often a dark spot in the middle on both edges....The renopericardiac prominence varies in shape from round to elongate and may be almost half of the length of the body. There is always only one principle vessel on either side. Their anterior and posterior branches collect a number of simple short vessels, which stand out as in [E.] serca (Fig. 40). The pharynx has no muscular inglovies. The teeth are slender and pointed sometimes coarsely serrulate, sometimes with fine denticles, sometimes smooth. The strongly muscular esophageal pouch is in some animals stretched, making part of the esophageal wall. The penis (Fig. 55) is about 1 mm long and 0.15-0.3 mm wide...near its tips it diminishes suddenly and ends with a narrow cylindrical section in which a 0.06 mm long cuticular tube with several folds standing out is lodged. Once two spermlytic vesicles were found in a 6-mm slug" (Marcus, 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This species is found in Florida, Puerto Rico, Curaςao, and Brazil (Marcus, 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

The length is 10-20 mm.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Most characteristic feature is the branching pattern of its dorsal vessels (Marcus, 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Syntype for Elysia tuca Marcus & Marcus, 1967
Catalog Number: USNM 576286
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): J. Maxwell
Locality: Soldier Key, Florida, United States, Biscayne Bay, North Atlantic Ocean
  • Syntype: American Opisthobranch Mollusks. pg. 29, fig. 28-32.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Found on and eating the following algae: Halimeda (preferred), Caulerpa, Thalassia, Udotea, and Penicillus (Marcus, 1980; Clark, 1984). Exposure to Halimeda spp. was found to induce metamorphosis in larvae (Krug, 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Like all sacoglossans, this species is a simultaneous hermaphrodite. The penis ends in a cylindrical, cuticular stylet (Marcus, 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Elysia tuca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAACAGGACTAAGTTTGTTAATTCGATTTGAGTTAGGGACATCCGGAGCCTTCTTAGGTGAT---GACCACTTTTATAATGTAATTGTAACGGCTCATGCCTTTGTTATAATTTTCTTCATAGTGATGCCTCTAATAATTGGGGGATTTGGTAATTGAATGGTACCAATTTTAATTGGTGCTCCTGACATAAGTTTCCCTCGTATGAATAATATGAGGTTTTGGTTACTTCCCCCTTCTTTTATTTTTCTTCTATGTTCAAGCCTCGTAGAAGGAGGTGCTGGGACAGGATGAACTGTCTACCCTCCACTAAGGGGTCCTATTGGCCATGGGGGTGCTTCCGTGGACTTGGCAATTTTTTCGCTGCATTTAGCTGGGATGTCATCTATTCTGGGTGCGGTAAACTTTATTACAACTATCTTTAATATGCGGTCCCCAGGTATAACTTTCGAGCGATTAAGTCTCTTCGTGTGGTCCGTACTAGTAACGGCCTTCTTATTGCTCCTATCCTTACCTGTGCTAGCTGGAGCAATTACTATACTGCTAACAGATCGCAACTTTAACACTAGCTTTTTCGATCCTGCAGGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Elysia tuca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

References

AlgaeBase as: Guiry, M.D. & Guiry, G.M. 2010. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org; searched on 27 December 2010.

Krug, Patrick J. 2009. Not My “Type”: Larval Dispersal Dimorphisms and Bet-Hedging in Opisthobranch Life Histories. Biological Bulletin 216: 355–372.

Marcus, E.D.B.R. (1980) Review of western Atlantic Elysiidae (Opisthobranchia ascoglossa) with a description of a new Elysia species. Bulletin of marine science 30: 54-79.

Valdés, Angel, Jeff Hammon, David Behrens, and Anne Dupont. 2006. Caribbean Sea Slugs. Sea Challengers Natural History Books. 289 pp.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Vendetti, Jann

Source: Cataloging Diversity in the Sacoglossa

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!