Overview

Distribution

The fat mucket is found from the Mississippi River drainage from New York to Minnesota. It occurs south to Arkansas but does not occur from the Tennessee and Cumberland River systems. In the St. Lawrence River system it is found in the Canadian Interior Basin. Lampsilis siliquoidea is also found in Montana and eastern Colorado.

In Michigan L. siliquoidea is found in drainages throughout the state, both in the upper and lower peninsulas.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs throughout the Mississippi River basin except for the Tennessee and Cumberland River basins. The range extends from western New York to Minnesota and Montana (Gangloff and Gustafson 2000) and south to Arkansas and west into eastern Kansas and Nebraska (Hoke 2005). It is found as far west as the eastern Colorado border and in Montana and is widespread throughout the interior of Canada, including the western Hudson Bay drainage (Parmalee and Bogan 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species occurs throughout the Mississippi River basin except for the Tennessee and Cumberland River basins. The range extends from western New York to Minnesota to Montana (Gangloff and Gustafson, 2000) and south to Arkansas and western into eastern Kansas and Nebraska (Hoke, 2005). It is found as far west as the eastern Colorado border and in Montana and is widespread throughout the interior of Canada, including the western Hudson Bay drainage (Parmalee and Bogan, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The fat mucket is up to 12.7 cm (5 inches) long , and is oblong to elliptical in shape. The shell thickness is uniform, and may be thin to thick. This species is sexually dimorphic. Depending on habitat, sex, and age, the shell can be compressed or inflated. The   anterior end is rounded, the posterior end bluntly pointed in males or truncated in females. The dorsal margin is straight and the ventral margin is straight and may be rounded.

Umbos are broad and raised only slightly above the hinge line. The beak sculpture is fine, with six to ten double-loops.

The periostracum (outer shell layer) is yellow to yellow-brown with green rays. Older specimens tend to be darker and brownish.

On the inner shell, the   left valve has two   pseudocardinal teeth, which are erect and compressed. The two lateral teeth are thin, short and slightly curved. The right valve has one large, erect pseudocardinal tooth. Anterior to this tooth is a smaller (lamellar) tooth. The one lateral tooth is thin and straight.

The beak cavity is shallow to moderately deep. Although the nacre is white, occasionally it is has a pink or salmon tint and iridescent posteriorly.

In Michigan, this species can be confused with the mucket and pocketbook. The mucket is generally more compressed and slightly more elliptically shaped. The pocketbook is more roundly shaped and has higher umbos.

Range length: 12.7 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Jass and Glenn (2004) found the species to be sexually dimorphic with males generally larger than females but females having posterior end inflation and more evenly rounded posterior margin (Jass and Glenn, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Although found in various substrates and in various habitats from lakes, and headwaters to medium sized rivers, the fat mucket is usually found in quiet water on sandy-mud bottoms. Occasionally it is found in riffles, but usually in waters below riffles, or slowly running water with fine gravel, sand and mud.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species occurs in freshwater river systems.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species is found on a variety of substrates but usually prefers quiet or slow-moving water with a mud bottom, typically avoiding riffles (Parmalee and Bogan, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Fish hosts are determined by looking at both lab transformations and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

The main hosts of Lampsilis siliquoidea are in the family Centrarchidae. Natural infections and glochidial metamorphosis have been observed on bluegill, black crappie, largemouth bass, walleye, white crappie and the yellow perch. Glochidial metamorphosis has also been observed on the longear sunfish, bluntnose minnow, sand shiner, sauger and smallmouth bass.

Ecosystem Impact: parasite

Species Used as Host:

  • Coker, R., A. Shira, H. Clark, A. Howard. 1921. Natural history and propagation of fresh-water mussels. Bulletin of the Bureau of Fisheries, 37: 77-181.
  • Cummings, K., G. Watters. 2004. "Mussel/Host Data Base" (On-line). Molluscs Division of the Museum of Biological Diversity at the Ohio State University. Accessed September 26, 2005 at http://128.146.250.63/Musselhost.
  • Howard, A. 1922. Experiments in the culture of fresh-water mussels. Bulletin of the Bureau of Fisheries, 38: 63-89.
  • O'Dee, S., G. Watters. 2000. New or confirmed host identifications for ten freshwater mussels. Captive Care, and Propagation of Freshwater Mussels Symposium,: 77-82.
  • Trdan, R. 1981. Reproductive biology of Lampsilis radiata siliquoidea (Pelecypoda: Unionidae). American Midland Naturalist, 106: 243-248.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: It is in every drainage (extirpated from Minnesota River) in most Minnesota Cos. (Sietman, 2003); incl. Red, Lake Superior, Lake of the Woods (Graf, 1997; Cvancara, 1970). In Illinois, it is in small/medium streams throughout (Cummings and Mayer, 1997; Schanzle and Cummings, 1991; Schanzle et al. 2004; Tiemann et al., 2005). Indiana: Blue (Sietman et al., 1995), Tippecanoe (Cummings and Berlocher, 1990), E Fork White (Harmon, 1992), Muscatatuck (Harmon, 1989), St. Joseph, Maumee and Eel (Pryor, 2005). In Ohio, it is throughout (Watters, 1992; 1995; Lyons et al., 2007; Grabarciewicz, 2008; Hoggarth et al., 2007; Watters et al., 2009). In West Virginia, it is in the Upper Ohio/Kanawha (Zeto et al., 1987) and Mud Rivers (Guyandotte drainage) (Schmidt and Zeto, 1986). In South Dakota it is in the Minnesota, upper/mid Big Sioux, James, Vermillion Rivers, and Lake Kampeska (Skadsen and Perkins, 2000; Backlund, 2000; Perkins and Backlund, 2003). In Montana, it is in most tribs. of the Missouri, Marais, Milk, Yellowstone, Little Missouri Rivers; less common in Tongue and Bighorn Rivers (Yellowstone basin), Battle and Beaver Creeks (Milk basin) (Gangloff and Gustafson, 2000; Stagliano, 2010). It is in Arkansas in the Poteau (Vaughn and Spooner, 2004), Cache (Christian et al., 2005), and mouth of White (Gordon, 1982). It is widespread and abundant in Wisconsin (Mathiak, 1979). In Mississippi, it is in the Mississippi River S, Big Black, and Yazoo drainages (Jones et al., 2005). It is rare in Louisiana, from Bayou Bartholomew, Tensas River (questionably) and nearby in W Mississippi (Vidrine, 1993). In Tennessee, it is only in Reelfoot Lake (nearly extirpated) and 1 Wolf trib. (Kesler and Manning, 1996) of the Mississippi (Parmalee and Bogan, 1998). It is statewide in Kentucky (Cicerello and Schuster, 2003); rarely in the Middle Green (Cochran and Layzer, 1993; Gordon, 1991), also S Fork Kentucky (Evans, 2008). It is widespread in Oklahoma in the Kiamichi, Blue, Clear Boggy and Little (Vaughn and Taylor, 1999; Vaughn, 2000) and Bird, Fourteenmile, Pryor and Big Cabin Creeks; Flint Creek; Haw Creek (LeFlore Co.); Glover Rivers and Pennington and Gates Creeks, Spring (Branson, 1966); Neosho, Mountain Fork (Spooner and Vaughn, 2007) and Blue Rivers and Honey and Sparrow Creek (Murray Co.); Poteau River; and Bird, Hominy and Salt Creeks (Branson, 1984). Kansas: Neosho, Marais des Cygnes, and Spring (Branson, 1966) basins, and (declined in Verdigris basin) still upper Fall and Caney Rivers but extirpated from Wakarusa (Tiemann, 2006), Republican, Solomon, Saline, Smoky Hill, Ninnescah, Walnut, and Cottonwood Rivers (Couch, 1997). Recently only dead shells in the Marais des Cygnes, Elk, and Fall Rivers, Kansas (Combes and Edds, 2005). In the Little Blue basin it is in the Kansas and Nebraska portions (Hoke, 2004). In the Big Blue system (SE Nebraska, NE Kansas) it was common as weathered valves and alive in W Fork Big Blue and a hole in the Big Blue mainstem, Nebraska (no recruitment) (Hoke, 2005). It is also known from the Clinton River drainage in Michigan (Trdan and Hoeh, 1993) and upper peninsula (Goodrich and Van der Schalie, 1939). It occurs in the Kalamazoo River (Mulcrone and Mehlne, 2001) and Lakes Michigan, Huron, and St. Clair drainages (Badra and Goforth, 2003), Michigan (Strayer, 1980; Trdan and Hoeh, 1993). Beetle (1989) lists Wyoming occurrences in Converse, Fremont, Natrona, and Platte Cos.; while Cvancara (2005) lists the Bighorn (Big Horn, Freemont Cos.), Tongue (Sheridan Co.), North Platte drainages (Natrona, Converse, Platte Cos.). In Canada it is widespread and abundant in Manitoba (Assiniboine- Watson, 2000; Pip, 2006), Ontario (Metcalfe-Smith et al., 2003), Quebec, Saskatchewan, and less abundant, but widespread in Northwest Territories, and Alberta (most SE of the Cordillera); and undetermined in Nunavut (Metcalfe-Smith and Cudmore-Vokey, 2004); recently Petitot River in British Columbia (BC CDC, pers. comm., 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Smith and Crabtree (2010) found this species at 9 of 32 sites (1 with recruitment) along the entire length of Pennsylvania's French Creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. Mantle flaps in the lampsilines are modified to attract potential fish hosts. While the fat mucket has a fish lure to attract its host fish, if or how it recognizes a specific host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Lampsilis siliquoidea is a long-term brooder, and was gravid from early August to late July in the Huron River, Michigan. It probably breeds in July and early August in Michigan.

Breeding interval: The fat mucket breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably June to July.

Average gestation period: 10 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Recorded host fishes include several sunfish and perch species (Watters, 1996). Draxler et al. (2006) confirmed glochidial transformation on several fish species including Lepomis macrochirus (bluegill), Perca flavescens (yellow perch), and Micropterus salmoides (largemouth bass).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampsilis siliquoidea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATTTATTGTTAGCGTTGTGGTCTGGTTTAGTTGGTTTGGCCCTAAGTCTTTTGATTCGGGCTGAGTTGGGGCAGCCAGGTAGGTTGTTGGGGGAT---GATCAGCTATATAACGTAATTGTGACGGCACATGCTTTTATAATAATTTTCTTTTTGGTTATACCAATAATAATTGGTGGTTTTGGTAATTGACTTATTCCGCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGATTGAATAATTTGAGTTTTTGGTTGTTAGTGCCAGCTTTGTTCTTATTATTGAGTTCTTCTTTGGTAGAGAGTGGTGTTGGGACTGGGTGGACGGTTTATCCACCATTGTCTGGGAATGTGGCTCATTCTGGGGCTTCGGTGGATTTGGCCATTTTTTCTTTGCATCTTGCTGGTGCTTCTTCTATTTTGGGGGCTATTAACTTTATTTCTACTGTTGGAAATATGCGATCTCCGGGGTTAGTTGCTGAGCGTATTCCGTTGTTTGTGTGGGCTGTTACGGTGACAGCGGTTTTATTGGTTGCATCGTTACCTGTTTTGGCTGGTGCTATTACAATATTACTTACTGATCGAAATATTAATACGTCTTTTTTTGATCCTGTGGGGGGAGGGGATCCTATTTTATAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lampsilis siliquoidea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Lampsilis siliquoidea is currently not listed for conservation status. However, it is commonly found in lakes, where zebra mussels have been thriving.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Cummings, K. & Cordeiro, J.

Reviewer/s
Bohm, M., Collen, B. & Seddon, M.

Contributor/s
Richman, N., Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., Milligan, HT, De Silva, R., Herdson, R., Thorley, J., McMillan, K., Collins, A., Offord, S. & Duncan, C.

Justification
Lampsilis siliquoidea has been assessed as Least Concern as it is extremely widely distributed and its populations appear to be stable and secure throughout its range, without any major threats affecting its global population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is extremely wide ranging and is stable and secure throughout its range.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There is insufficient population data available, although this species is reported to be stable throughout its range (NatureServe 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is unlikely that there are any threats impacting this species on a global scale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been assigned a NatureServe Global Heritage Status Rank of G5 - Secure, due to it being "extremely wide ranging and is stable and secure throughout its range" (NatureServe 2009). No wide ranging conservation actions have been undertaken for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: This species occurs in Muddy Creek (French Creek drainage) in the Erie NWR in Crawford Co., Pennsylvania (Mohler et al., 2006). Specimens from the Black River (St. Clair drainage), Michigan, were relocated to the Detroit River in 1992 (Trdan and Hoeh, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Lampsilis siliquoidea

Lampsilis siliquoidea, also known as the Fatmucket Clam, is a species of freshwater bivalve in the Unionidae family.

Description[edit]

L. siliquoidea is recognized by its brown shell with dark rays, and is usually about 70 to 100 mm in size. The shape of the shell is oblong to elliptical, compressed or inflated, with uniform thickness. Fatmucket Clams are filter feeders. They feed on algae, phytoplankton, protozoans and organic particles. In the parasitic glochidial stage they feed on blood from hosts species, which include bass, perch, walleye, and sturgeon.

Distribution and habitat[edit]

It is widespread in North America, found in the drainages of both the Mississippi River from New York to Minnesota, the Great Lakes, and Hudson Bay. It lives in lakes, rivers, streams and quiet waters, usually on sandy-mud bottoms.

References[edit]

  • Turgeon, D. D., A. E. Bogan, E. V. Coan, W. K. Emerson, W. G. Lyons, W. Pratt, et al. (1988) Common and scientific names of aquatic invertebrates from the United States and Canada: mollusks, American Fisheries Society Special Publication 16
  • Turgeon, D. D., J. F. Quinn, Jr., A. E. Bogan, E. V. Coan, F. G. Hochberg, W. G. Lyons, et al. (1998) Common and scientific names of aquatic invertebrates from the United States and Canada: Mollusks, 2nd ed., American Fisheries Society Special Publication 26
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The combination Lampsilis radiata luteola has been used incorrectly in place of Lampsilis siliquoidea and resulted in some confusion. For example, Lampsilis radiata luteola cited in Oesch (1984; 1995) is actually Lampsilis siliquoidea but the two names are not considered synonyms nor is siliquoidea considered a form or subspecies of radiata. Unio (= Lampsilis) luteola, previously confined to the Susquehanna and Mohawk Rivers (Johnson, 1969), falls within the overall range of and is considered a junior synonym of Lampsilis radiata and not as a senior synonym of Lampsilis siliquoidea (see Turgeon et al., 1998). Note Watters et al. (2009) conclude that Unio siliquoidea Barnes, 1823, is a junior synonym of Unio luteola Lamarck, 1819, that intergraded with Lampsilis radiata radiata in northern New York in the Finger Lakes, Erie Canal, Mohawk, and upper Susquehanna Rivers; and therefore synonymize Lampsilis siliquoidea with Lampsilis radiata as a subspecies- Lampsilis radiata luteola.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!