Overview

Brief Summary

Introduction

Spirula spirula is a small, muscular species (45 mm ML) found in mesopelagic waters of the tropical open ocean. In the title photographs, the skin of the mantle is missing. The intact mantle is covered with regularly aligned collagen fibers that produce a silvery sheen, as seen on the head in the title photographs (Herring et al., 1981). Spirula carries an unusual internal shell that is calcareous and has the shape of a horn coiled in a single plane without the coils touching one another (open planispiral).

Figure. Left - Side view of the shell of Spirula. Photograph by R. Young of a shell found on a Florida beach. Right - Cut-away view of the shell provided by ray tomography showing the phragmocone with septa and siphuncle. Photograph taken by the atomic and nuclear physics group from the University of Fribourg in Switzerland, and provided by Hans Ueli Johner.

The shell, which retains the phragmocone and siphuncle of its distant ancestors, is used as a buoyancy device. The posterior position of the shell within the body causes the animal to generally orient vertically with the head downward. The unusual general appearance of Spirula with a narrow arm crown, bulging eyes, the peculiar structure of the mantle, the transverse orientation of the fins and the presence of the coiled shell makes this species very different in appearance from all other cephalopods.

The large posterior guard-like sheath of fossil relatives of Spirula seems to be designed to function as a counterweight to maintain the animal in a horizontal position. Such an orientation is particularly important for a bottom-associated animal that swims just above the ocean floor (Naef 1921-23). Presumably the ancestors of Spirula were bottom associated and some remnants of this behavior apparently remains in their life history and distribution (Young, et al., 1998). A small remnant of the sheath exists on the Spirula shell and a remnant of the ancestral habitat remains in Spirula's apparent benthic spawning (Young, et al., 1999).

Brief diagnosis:

A decapodiform ...

  • with a calcareous shell that is a phragmocone and has the shape of a coiled horn.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Nomenclature

A list of all nominal genera and species in the Spirulidae can be found here. The list includes the current status and type species of all genera, and the current status, type repository and type locality of all species and all pertinent references.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Characteristics

  1. Arms
    1. Arms with suckers in four series.
    2. Both arms IV hectocotylized.

  2. Tentacles
    1. Tentacular clubs without proximal locking apparatus.
    2. Tentacular clubs with suckers in 16 series; not divided into manus and dactylus.
    3. Club suckers without circularis muscles.

      Figure. Oral view of tentacular club of S. spirula. Drawing from Chun (1910).

  3. Head
    1. Head with tentacle pockets.
    2. Eyes without corneas.

  4. Funnel
    1. Funnel without lateral adductor muscles.

  5. Mantle
    1. Mantle locking-apparatus does not reach anterior mantle margin.

  6. Fins
    1. Fins separate, terminal and lie in a plane nearly transverse to body axis.
    2. Fins with posterior lobes.

  7. Photophores
    1. Large photophore at posterior end of body.

  8. Shell
    1. Calcareous shell a phragmocone, curved ventrally in open planispiral; round in cross section and possessing a ventral siphuncle and transverse septa.

  9. Viscera
    1. Gills without brachial canal.
    2. Right oviduct absent.
    3. Females with accessory nidamental glands.
    4. Radula absent.
    5. Ink sac reduced.
    6. Anal flaps absent.
    7. Digestive gland paired; esophagus passes between members of the pair.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The distribution of Spirula spirula is poorly known. These mollusks are generally found in tropical waters, including the waters off the coasts of Indonesia, New Zealand, south Africa, northwestern Africa, the Canary Islands, and in the Gulf of Mexico. Nesis (1987) described this species as "tropical Atlantic and Indo-West Pacific mesopelagic nerito-oceanic."

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Ram's Horn squid (Spirula spirula) occurs throughout the tropical and subtropical oceanic regions of the world (Reid 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical and subtropical oceanic waters worldwide, where the water temperature at 400 m is 10ºC or warmer
  • Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Westrern Atlantic: Cape Cod to the West Indies
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-(sub)tropical
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vertical distribution

Clarke (1969) found that Spirula occurs at depths between 550 and 1000 m during the day (peak distribution is at 600-700 m) and at night migrates into the upper 100-300 m (peak at 200-300 m).

Figure. Graph of 70 Spirula spirula captured with opening/closing nets near the Canary Islands, eastern North Atlantic (Clarke, 1969). Yellow circles- Day captures. Blue triangles- Night captures. Oversized symbols represent two captures.

Geographical distribution

Most captures come from the tropical Atlantic and tropical IndoWest Pacific Oceans. Bruun (1943) found that Spirula is distributed mostly over the slopes of continents or islands where the bottom depth is between 1000 and 2000 m. The most numerous captures came from the vicinity of oceanic islands. Indeed, this animal was the most abundant midwater cephalopod collected in the region of the Canary Islands by Clark (1969).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rothschild (2004) reports that Spirula spirula shells are sometimes found on beaches in the Northern Gulf of Mexico.

  • Rothschild, S. B. 2004. Beachcomber's Guide to Gulf Coast Marine Life. Texas, Louisiana, Mississippi, Alabama, and Florida. Third Edition. Taylor Trade Publishing, Lanham.
Public Domain

Supplier: Katja Schulz

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Members of the genus Spirula are decapods characterized by suckered appendages, including 8 arms and 2 longer tentacles. They are somewhat squid-like in appearance, and young individuals can completely withdraw the head and all extremities into the mantle. Adults measure 30 to 45 mm in length, and can only retract the cephalic area halfway into the mantle.

The skin is reddish-brown and smooth. Members of the genus Spirula have a large photophore (bioluminescent light organ) at the posterior end of the mantle which is surrounded by two small, round fins. The photophore can remain illuminated for several hours.

The shell of S. spirula in entirely enclosed in the mantle. It is divided into approximately 25 to 37 chambers connected by a siphuncle. This shell serves as a hydrostatic system, allowing and animal to control its buoyancy. The shell is located in the posterior half of the mantle, and its buoyancy pattern results in a characteristic "head down" positioning often observed in Spirula.

Range length: 30 to 45 mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes shaped differently

  • Cousteau, J., P. Diole. 1973. Octopus and Squid The Soft Intelligence. Garden City, NY: Doubleday & Company, Inc..
  • Ward, P. 1987. The Natural History of Nautilus. Boston, MA: Allen & Unwin Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Spirula spirula is most often found on continental shelves at depths ranging between 500 and 1000 m during the day. Because of their hunting patterns, these cephalopods are found closer to the surface at night, at depths between 100 and 300 m.

Range depth: 100 to 1000 m.

Average depth: 500 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: pelagic

  • Moynihan, M. 1985. Communication and Noncommunication by Cephalopods. Bloomington, IN: Indiana University Press.
  • Hanlon, R., J. Messenger. 1996. Cephalopod Behaviour. Cambridge, UK: Press Syndicate of the University of Cambridge.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species has a very wide geographic and depth distribution (from 300 to 1,750 m) (Reid 2005). Adults generally occur between 600 and 700 m in depth during the day, rising to less than 300 m to feed at night (Reid 2005). Paralarval planktonic young have been caught between 1,000 and 1,750 m, suggesting females spawn their small eggs on the bottom of the continental slopes (Reid 2005). Sexual maturity is attained at 30 mm in mantle length and between 12 and 15 months in age and they probably live for about 18-20 months (Reid 2005). Mature males have modified ventral arms that lack suckers and are tipped with finger-like outgrowths (Norman 2003, Reid 2005). The species is characterised by a small internal coiled shell (Norman 2003). It also has a large, upward facing light organ, the purpose of which is unknown (Norman 2003). This species forms schools and can sometimes be very abundant (Norman 2003). Live animals drift in a vertical position with their head and arms hanging down which it can retract into its mantle cavity (Norman 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This is a mesopelagic species, inhabiting from 600 to 700 m during the day and found in depths less than 300 m at night. Capture of young at depths between 1 000 and 1 750 m suggests that females possibly lay eggs on the bottom of continental slopes
  • Jereb, P.; Roper, C.F.E. (Eds)(2005). An annotated an illustrated catalogue of cephalopod species known to date. Volume 1: Chambered nautilusses and sepioids (Nautilidae, Sepiidae, Sepiolidae, Sepiadariidae, Idiosepiidae and Spirulidae). FAO Species Catalogue for Fishery Purposes 4(1). FAO, Rome. 262p., 9 colour plates.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

oceanic, pelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 59 specimens in 1 taxon.
Water temperature and chemistry ranges based on 43 samples.

Environmental ranges
  Depth range (m): 0 - 2150
  Temperature range (°C): 2.337 - 25.334
  Nitrate (umol/L): 0.570 - 38.993
  Salinity (PPS): 34.361 - 36.586
  Oxygen (ml/l): 2.343 - 5.468
  Phosphate (umol/l): 0.074 - 2.810
  Silicate (umol/l): 0.993 - 127.695

Graphical representation

Depth range (m): 0 - 2150

Temperature range (°C): 2.337 - 25.334

Nitrate (umol/L): 0.570 - 38.993

Salinity (PPS): 34.361 - 36.586

Oxygen (ml/l): 2.343 - 5.468

Phosphate (umol/l): 0.074 - 2.810

Silicate (umol/l): 0.993 - 127.695
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In general, the specific feeding habits of S. spirula resemble that of the family Sepulidae. Spirula spirula hunts nocturnally, probably consuming small fish and crustaceans. The feeding apparatus of S. spirula consists of a beaked mouth containing a radula, towards which food is propelled by the tentacles.

Members of the Sepulidae typically consume 30 to 60% of their body weight per day, so it can be assumed that the general food intake for S. spirula, while perhaps not being quite as high, is a sizeable amount.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms; cnidarians; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Spirula spirula is a common food source for swordfish, and may also provide nourishment for marine animals such as whales and other carnivores.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators for S. spirula include great-winged petrels, splendid alfoniso fish, and swordfish. Whales may also be one of the main predators of cephalopods, including S. spirula.

In other cephalopods, predator evasion mechanisms include photophores and bioluminescence, which could account for the presence of the bioluminescent organ in S. spirula. However, details of how this may be used are not available.

Known Predators:

  • Great-winged petrel
  • splendid alfoniso Bleryx splendens 
  • swordfish Xiphias gladius 

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Although specific means of communication are relatively unknown for this species, its light-emitting organ may be a key source of communication between these animals. At least during mating, some physical contact and communication must occur between males and females, as the male must inseminate the female. In addition to this, S. spirula may employ chemical signalling.

Communication Channels: visual ; tactile ; chemical

Other Communication Modes: photic/bioluminescent

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spirula is able to withdraw its head and arms completely within the mantle; the mantle opening can then be closed by folding over the large dorsal and ventrolateral extensions (= flaps) of the mantle margin (Bruun, 1943). The photophore at the posterior end of the body is known to glow for hours at a time (Schmidt, 1922). When swimming slowly downward, head first, the terminal fins are pointed upward (i.e. posteriorly) and move with a rapid "waving or fluttering motion" that propels the animal downward (Bruun, 1943).

Virtually all cephalopods have mobile irises but for an oceanic, pelagic decapodiform the extreme contraction seen below in Spirula is unusual.

Figure. Views of the iris of Spirula spirula, 23 mm ML, western North Atlantic. Left - Dorsal view. Right - Dorsal-oblique view. Note the wide-open eyelid and the strongly contracted iris leaving a tiny pupil. Photogaphs by M. Vecchione.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Individuals measuring about 2 mm hatch from fertilized eggs. The young are independent, and no pelagic eggs have ever been identified. It is theorized that females lay eggs at the benthic layer. Capture of young hatchlings that closely resemble adult forms at this lower layer lends support to this idea.

Sexes, male and female, are spearate. The process for sex determination in Spirula has not been determined.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

Mature ovarian eggs are 1.7 mm in the longest diameter (Bruun, 1943). Bruun (1943) suggests that the eggs are laid on the ocean floor and the capture of very small animals in deep water supports this idea (Bruun, 1943; Clarke, 1970). Clarke (1970) described a small squid with a mantle length of just over 2 mm and Bruun (1943) illustrated a similar squid that had a shell with just two chambers. These squid are, or are very close to being, hatchlings. The eyes in these individual are small and the buccal mass is very large with the beaks extending beyond the short arms. Note that only three arm pairs are present.

Figure. Views of paralarvae of Spirula spirula. Left - Ventral view. Drawing from Clarke (1970). Right - Drawing from Bruun (1943).

The shift in size frequency distribution over time in the region of the Canary Islands suggests to Clarke (1970) that this cephalopod has a life-span of 18-20 months. The ventral arms of the male are hectocotylized: They are much longer and thicker than the other arms (see title photograph) and possess a variety of unusual flaps and papillae but lack suckers.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Average life span for S. spirula is 1 to 1.5 years; very few specimens are captured and captivity life span is unknown.

Range lifespan

Status: wild:
1.5 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females are slightly larger than males, and as of yet no courtship rituals been identified in ram's horn squids. The breeding season for this species is unknown. The social structure in Spirula is also unknown.

Reproduction in Spirula is similar to reproduction in most cephalopods, where a modified tentacle on the male (the hectocotylus) is used to implant a sperm sac into the seminal receptacle in buccal membrane of the female's mantle during mating. The time until hatching is unknown for Spirula.

The breeding patterns in S. spirula are unknown.

Breeding interval: The breeding interval is unknown.

Breeding season: The breeding season has not been identified.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Females provide eggs with the nutrients needed to reach hatching successfully. Newly hatched offspring are independent. Any other details on the parental behavior of this species are lacking in the literature.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Hanlon, R., J. Messenger. 1996. Cephalopod Behaviour. Cambridge, UK: Press Syndicate of the University of Cambridge.
  • Nesis, K. 1987. Cephalopods of the World. Neptune City, NJ: T.F.H. Publications, Inc..
  • Licensed under the GNU Free Documentation License. 2005. "Ram's Horn Squid- Wikipedia, the free encyclopedia" (On-line). Wikipedia, the free encyclopedia. Accessed October 13, 2005 at http://en.wikipedia.org/wiki/Spirulida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Spirula spirula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATACTTCATTTTTGGAATTTGAGCAGGATTACTAGGTACTTCCTTAAGCTTAATAATCCGAACTGAGTTAGGACAACCAGGATCACTATTAAATGAT---GATCAATTATATAATGTAGTAGTTACCGCCCACGGATTTATTATAATTTTTTTTTTGGTTATACCTATTATAATTGGGGGGTTTGGAAACTGATTAGTACCTTTAATACTAGGAGCCCCAGATATAGCCTTCCCACGAATAAATAATATAAGATTTTGACTACTACCTCCTTCTCTTACTTTACTACTAATATCTGCAGCTGTTGAAAGAGGGGCTGGAACAGGTTGAACAGTATACCCACCCTTATCTAGAAATATCTCCCACGCAGGTCCCTCAGTTGATTTAGCCATTTTCTCCCTTCACTTAGCAGGGGTATCTTCTATTTTAGGAGCAATTAACTTCATCACTACAACTTTAAATATACGCTGAGGAGGGCTACAAATAGAACGAGTACCACTTTTTGTTTGATCAGTATTTATTACTGCTATTTTATTACTTCTATCACTTCCAGTTTTAGCAGGAGCAATTACTATACTATTAACAGACCGAAATTTTAATACCACCTTTTTTGACCCAAGGGGGGGAGGGGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Spirula spirula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Spirula spirula is not listed under any of the databases for endangered species.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Barratt, I. & Allcock, L.

Reviewer/s
Reid, A., Rogers, Alex & Bohm, M.

Contributor/s
Herdson, R. & Duncan, C.

Justification
Spirula spirula is assessed as Least concern because of its extensive distribution. It is found throughout the tropical and subtropical oceans of the world and this distribution minimizes its susceptibility to local impacts. Even if it is shown to be two separate species (one in the northern hemisphere and one in the southern hemisphere), then each of these will also have an extensive range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are no population size estimates available for this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The threats to this species are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation actions needed or in place for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of S. spirula on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is a common food source for swordfish (Xiphias gladius), so that it impacts swordfish populations and therefore the commercial swordfish market.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spirula

Spirula spirula is a species of deep water squid-like cephalopod mollusk. It is the only extant member of the genus Spirula, the family Spirulidae, and the order Spirulida. Because of the shape of its internal shell, it is commonly known as the ram's horn squid[3] or the little post horn squid. Because the live animal has a light-emitting organ, it is also sometimes known as the tail-light squid.

Live specimens of this cephalopod are very rarely seen, because it is a deep-ocean dweller. The small internal shell of the species is however quite a familiar object to many beachcombers. The shell of Spirula is extremely light in weight, very buoyant and surprisingly strong; it very commonly floats ashore onto tropical beaches (and sometimes even temperate beaches) all over the world. This seashell is known to shell collectors as the ram's horn shell or simply as Spirula.

Description[edit]

Spirula have a squid-like body between 35 mm and 45 mm long. They are decapods, with 8 arms and 2 longer tentacles, all with suckers. The arms and tentacles can all be withdrawn completely into the mantle.

The species lacks a radula[4]:110[5]:26 (or, at most, has a vestigial radula).[6]

Female with dissected mantle cavity (left) and immature specimens at various stages of development (centre and right)

Shell[edit]

The most distinctive feature of this species is its buoyancy organ, an internal, chambered, endogastrically coiled[6] shell in the shape of an open planispiral (a flat spiral wherein the coils do not touch each other), and consisting of two prismatic layers.[6] The shell functions to osmotically control buoyancy;[6] the gas-filled chambers keep the spirula in a vertical, head-down attitude.[6]

Lateral (left) and ventral (centre) views of a Spirula shell. In the latter, the siphuncle and the last septum of the phragmocone are visible. The position of the shell inside the mantle is shown in the illustration on the right.

Behaviour[edit]

End of mantle showing the photophore

Spirula are capable of emitting a green light from a photophore located at the tip of their mantle, between the ear-shaped fins.[6]

Habitat and distribution[edit]

By day Spirula lives in the deep oceans, reaching depths of 1,000 m. At night, they rise to a depth of 100 to 300 m.[7] Their preferred temperature is around 10°C, and they tend to live around oceanic islands, near the continental shelf.[6]

Most sources cite this species as tropical, and they are observed to be plentiful in the seas around the Canary Islands. However, significant quantities of shells from dead Spirula are washed ashore even in temperate regions, such as the western coasts of South Africa and New Zealand. Because of the great buoyancy of the shells, these may possibly have been carried long distances by ocean currents.

Much of the organism's life history has not been observed; for instance, they are thought to spawn in winter in deeper water, yet no spawnlings have been directly seen. They must occasionally venture into the upper 10 metres of the sea, for they are sometimes found in albatross guts.[8]

Evolutionary relationships[edit]

Illustration of live animal
Oral view of the left tentacular club

The order Spirulida also contains two extinct suborders: Groenlandibelina (including extinct families Groenlandibelidae and Adygeyidae), and Belopterina (including extinct families Belemnoseidae and Belopteridae).

Spirula is likely the closest living relative of the extinct belemnites and aulacocerids. These three groups as a unit are closely related to the cuttlefish, as well as to the true squids.

See also[edit]

References[edit]

  1. ^ Hayward, B.W. (1977). "Spirula (Sepioidea: Cephalopoda) from the Lower Miocene of Kaipara Harbour, New Zealand (note)". New Zealand Journal of Geology and Geophysics. doi:10.1080/00288306.1976.10423557. 
  2. ^ Barratt, I. & Allcock, L. (2012). Spirula spirula. The IUCN Red List of Threatened Species. Version 2014.2.
  3. ^ Norman, M. 2000. Cephalopods: A World Guide. Hackenheim, ConchBooks.
  4. ^ Nixon, M (1985), "The buccal mass of fossil and recent Cephalopoda", in Wilbur, Karl M., The Mollusca, New York: Academic Press, ISBN 0-12-728702-7 
  5. ^ Landman, Neil H; Tanabe, Kazushige; Davis, Richard Arnold (1996). Ammonoid paleobiology by Neil H. Landman, Kazushige Tanabe, Richard Arnold Davis. ISBN 978-0-306-45222-2. 
  6. ^ a b c d e f g Warnke, K.; Keupp, H. (2005). "Spirula—a window to the embryonic development of ammonoids? Morphological and molecular indications for a palaeontological hypothesis". Facies 51: 60. doi:10.1007/s10347-005-0054-9.  edit
  7. ^ Clarke, M. R. (2009). "Cephalopoda collected on the SOND Cruise". Journal of the Marine Biological Association of the United Kingdom 49: 961. doi:10.1017/S0025315400038042.  edit
  8. ^ Price, G. D.; Twitchett, R. J.; Smale, C.; Marks, V. (2009). "Isotopic Analysis of the Life History of the Enigmatic Squid Spirula Spirula, with Implications for Studies of Fossil Cephalopods". PALAIOS 24 (5): 273–279. doi:10.2110/palo.2008.p08-067r.  edit
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!