Overview

Distribution

Gulf of St. Lawrence (unspecified region), northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: eastern Bradelle Valley), Magdalen Islands (from eastern Bradelle valley to the west, as far as Cape North, including the Cape Breton Channel), Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway), lower St. Lawrence estuary, middle North Shore (from Sept- Iles to Cape Whittle, including the Mingan Islands); western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; North Carolina
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 638 specimens in 1 taxon.
Water temperature and chemistry ranges based on 22 samples.

Environmental ranges
  Depth range (m): -99 - 260
  Temperature range (°C): 6.405 - 16.407
  Nitrate (umol/L): 1.399 - 16.387
  Salinity (PPS): 32.546 - 35.060
  Oxygen (ml/l): 4.520 - 6.535
  Phosphate (umol/l): 0.390 - 1.251
  Silicate (umol/l): 1.668 - 15.041

Graphical representation

Depth range (m): -99 - 260

Temperature range (°C): 6.405 - 16.407

Nitrate (umol/L): 1.399 - 16.387

Salinity (PPS): 32.546 - 35.060

Oxygen (ml/l): 4.520 - 6.535

Phosphate (umol/l): 0.390 - 1.251

Silicate (umol/l): 1.668 - 15.041
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Yoldia limatula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TACTTTATTATTGGATTATGAGCAGGAATAATAGGAACCACTTTAAGGTTGATAATCCGTTTGAATTTACGGGTTCCTGGAAGAAAGTTATTCGAT---CCGCATATATATAATGTGATTGTTACGGCACACGCATTAATTATGATTTTTTTTATGGTTATGCCCGTAATATTAGGGGGTTTTGGAAATTGACTCGTCCCTTTAATATTAGGTGTGCCTGATATGTGTTATGCACGTCTAAACAATTTAAGGTTTTGGTTGGTTCCTTATGCTTTATTATGTTTATTAATATCAGTGATGTTTGATAAAGGGGCAGGAACAGGTTGAACTATGTACCCTCCTCTTTCTAGCTATAACTATCATACGGGGACCAGGGTTGATCTGGCATGTGTTTCATTACACTTGTCAGGTTTATCCTCTTTATTGGGGTCTATAAATTTTATGGCCACTATTGTGATAATGCGACCAAAGGAAGAAACTTGAGATAAAATTGCTTTATTGCCATGTGCTATTTGTGTCACGAGATTTTTGTTACTGATCTCTTTGCCTGTATTGGGGGGGGGTGTGACAATACTGATCGCAGATCGGCATTTTAATACAACTTTTTTTATCCCTAAAGGTGGTGGGGACCCGGTGTTATTTCAGCATTTATTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Yoldia limatula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yoldia limatula

Yoldia limatula, or the file yoldia, is a clam in the family Yoldiidae. It can be found along the Atlantic coast of North America, from the Gulf of St. Lawrence to New Jersey, as well as along the Pacific coast, from Alaska to San Diego.[1]

References

  1. ^ Abbott, R.T. & Morris, P.A. A Field Guide to Shells: Altantic and Gulf Coasts and the West Indies. New York: Houghton Mifflin, 1995. 6.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!