Overview

Distribution

Gulf of St. Lawrence (unspecified region), Saguenay Fjord, upstream part of middle St. Lawrence estuary, northern Gaspe waters, southern Gaspe waters (Baie des Chaleurs, Gaspe Bay to American, Orphan and Bradelle banks; eastern boundary: Eastern Bradelle Valley), lower St. Lawrence estuary, Laurentian Channel (bathyal zone)(=Honguedo Strait); lower North Shore.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 533 specimens in 1 taxon.
Water temperature and chemistry ranges based on 452 samples.

Environmental ranges
  Depth range (m): 0 - 1180
  Temperature range (°C): -0.862 - 14.966
  Nitrate (umol/L): 2.055 - 19.241
  Salinity (PPS): 33.276 - 35.986
  Oxygen (ml/l): 4.006 - 6.915
  Phosphate (umol/l): 0.353 - 1.251
  Silicate (umol/l): 2.559 - 15.041

Graphical representation

Depth range (m): 0 - 1180

Temperature range (°C): -0.862 - 14.966

Nitrate (umol/L): 2.055 - 19.241

Salinity (PPS): 33.276 - 35.986

Oxygen (ml/l): 4.006 - 6.915

Phosphate (umol/l): 0.353 - 1.251

Silicate (umol/l): 2.559 - 15.041
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

variety of microscopic plants and animals
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chaetoderma nitidulum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACTCTATATCTTCTTCTAGGACTAATCTCAGGATTAGTAGGAGCAAGTCTAAGAATAATAATCCGAATCGAGCTTGGACAACCAGGGAGATTTATAGGAAAT---GATCAGCTCTACAATGTAATCGTGACAGCTCACGCTTTTGTGATAATTTTTTTCATAGTAATACCTATAATAATAGGAGGATTTGGAAACTGACTCCTACCCCTTATATTAGGTGTGCCAGATATGGCCTTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCTCCCTCCTTAATTCTTCTTCTTAGATCAGCTGGAGTAGGTAGAGGTGCCGGCACCGGATGAACTGTCTACCCTCCTCTTGCAAGAGCTATAAGTCATAGAGGAGCCTCAGTAGACCTAGCTATTTTCTCTCTTCACCTCGCAGGGGCCTCTTCAATCATAGGTTCAATTAATTTTATTTCTACAGTCATAAATATACGATCAAAAGGATTCCAACTAGAACAGCTTCCCTTATTTGTATGATCCGTAAAAATTACAGCTATCCTTTTACTTTTAAGACTCCCCGTTCTAGCTGGTGCAATCACTATACTTCTCACAGACCGCAACTTTAATACCTCCTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTCTTTACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chaetoderma nitidulum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!