Overview

Comprehensive Description

Biology/Natural History: A very common inhabitant of the lower midlittoral (zone 3), where it often dominates the substrate in waveswept areas (picture). Specializes in living on large boulders and bedrock. Can move slowly from place to place by systematically breaking and remaking byssal threads. A filter feeder, filters 2-3 liters/hour. Spawns all year but spawning peaks in July and December in CA. A favorite prey of the seastar Pisaster ochraceous (picture). Small mussels are eaten by seabirds and by the oyster drill snails Nucella emarginata,Ceratostoma nuttali, and Roperia poulsoni, although it is less vulnerable to predation by snails than is M. trossulus (Wootton, 2002). In central CA parasitic isopods are often in the mantle cavity, as is also a pycnogonid and a pea crab. May become poisonous in summer months through ingestion of dinoflagellates, especially Gonyaulax catanella (causes paralytic shellfish poisoning).

Although this species may experience high flow in the intertidal environment due to wave action, byssal thread production seems to be limited to flows of < 50 cm/s. Mussel aggregations sharply reduce water flow within them and make possible the production of byssal threads (Carrington et al., 2008)

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

This mussel shell has a thick profile and the anterior end (umbo) is sharply pointed. It has strong radial ribs and irregular transverse growth lines. Parts of shell are often eroded. The periostracum is usually heavy and blue-black. The shell interior is blue-gray, may be slightly iridescent. Attach to rocks by byssal threads.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Irish Exclusive economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical Range: Aleutian Islands to Baja California

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: The most similar local mussel species is the blue or bay mussel, Mytilus trossulus. M. trossulus has a smoother shell and is often wider than M. californianus for its length. Mature M. californianus are distinguished especially by the strong radial ribs and irregular transverse growth lines, which M. trossulus does not have. M. galloprovincialis lives in the southern end of M californianus' range (from central CA south), and is nearly indistinguishable from M. trossulus. Mixed clusters of M. californianus and M. galloprovincialis can be found on the open coast in southern areas. M. trossulus seldom has much presence in the northern wave-exposed coasts, so exposed mussel beds are mostly M. californianus.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 81 samples.

Environmental ranges
  Depth range (m): -2 - 73.2
  Temperature range (°C): 7.261 - 10.345
  Nitrate (umol/L): 5.634 - 14.311
  Salinity (PPS): 31.692 - 32.487
  Oxygen (ml/l): 5.882 - 6.656
  Phosphate (umol/l): 0.883 - 1.602
  Silicate (umol/l): 12.975 - 33.391

Graphical representation

Depth range (m): -2 - 73.2

Temperature range (°C): 7.261 - 10.345

Nitrate (umol/L): 5.634 - 14.311

Salinity (PPS): 31.692 - 32.487

Oxygen (ml/l): 5.882 - 6.656

Phosphate (umol/l): 0.883 - 1.602

Silicate (umol/l): 12.975 - 33.391
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth Range: Intertidal to 24 m

Habitat: Common in intertidal zone 3 (lower midlittoral). Less common subtidally. Clings to rocks in wave-exposed areas, especially on the open coast.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Mytilus californianus is prey of:
Pisaster
Leptasterias
Thais emarginata

Based on studies in:
USA: Washington (Littoral, Rocky shore)
USA: Washington, Cape Flattery (Littoral, Rocky shore)
USA: California, Monterey Bay (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • B. A. Menge and J. P. Sutherland, Species diversity gradients: synthesis of the roles of predation, competition and temporal heterogeneity, Am. Nat.
  • R. T. Paine, Food webs: linkage, interaction strength and community infrastructure, J. Anim. Ecol. 49:667-685, from p. 670 (1980).
  • P. W. Glynn, Community composition, structure, and interrelationships in the marine intertidal Endocladia Muricata - Balanus glandula association in Monterey Bay, California, Beaufortia 12(148):1-198, from p. 133 (1965).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Mytilus californianus preys on:
detritus
plankton
phytoplankton
zooplankton

Based on studies in:
USA: Washington (Littoral, Rocky shore)
USA: Washington, Cape Flattery (Littoral, Rocky shore)
USA: California, Monterey Bay (Littoral, Rocky shore)

This list may not be complete but is based on published studies.
  • B. A. Menge and J. P. Sutherland, Species diversity gradients: synthesis of the roles of predation, competition and temporal heterogeneity, Am. Nat.
  • R. T. Paine, Food webs: linkage, interaction strength and community infrastructure, J. Anim. Ecol. 49:667-685, from p. 670 (1980).
  • P. W. Glynn, Community composition, structure, and interrelationships in the marine intertidal Endocladia Muricata - Balanus glandula association in Monterey Bay, California, Beaufortia 12(148):1-198, from p. 133 (1965).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mytilus californianus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 60 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGATAAAAATATTTAAAAAAGAGGAAAGAGGCGGTTACGGTGAAGTAGAATCTTGGTGACGTCGTTGACTTTGGTCAACAAATCATAAAGATATTGGAACCCTTTATCTATATAGAGGGGTGTGAGGAGGTTTATTTGGGGCAAGATTGAGTTTGATAATTCGAATGCAATTAGGGCATCCTGGAGCAGTCTTCCTAAAAAGAGATTGATTCTATAATGTGGTTGTTACAACGCATGCTTTAATAATAATTTTCTTTGCTGTAATACCAATTTTAATCGGGGCTTTTGGTAATTGGCTTATTCCTTTGCTTGTAGGGGGAAAAGACATAATCTATCCACGTATAAATAATTTGAGATATTGACTGTCGCCAAATGCACTATATTTATTAATGCTATCTTTTAGAACAGATAAAGGAGTAGGGGCAGGATGGACTATTTATCCACCTCTATCTGTATACCCTTATCACAGAGGGCCTAGGATAGATGTTCTTATTGTGTCTTTACACTTAGCAGGACTTAGCTCTCTAGTGGGGGCAATTAATTTTGCTAGCACAAATAAAAATATACCAGTATTAGAAATAAAAGGGGAACGGGCGGAGCTCTATGTGTTTAGAATTAGGGTTACTGCAGTTCTTTTAATTATCTCAATTCCAGTGTTAGGAGGGGGTATCACAATAATTCTGTTTGATCGTAACTTTAACACTACTTTCTTTGACCCTGCAGGGGGGGGTGACCCAGTACTATTTCAGCATTTGTTCTGGTTCTTTGGTCATCCTGAAGTATATATTCTTATTTTGCCTGCTTTTGGGGTAATGTCAAAGGTAATTATGCATTGTTCTGGAAAAGAAGCAGTGTTTGGGCTAATTGGGATGGTTTATGCTATGATTGGAATTGGAGGTTTAGGTTGTATGGTGTGAGCACATCATATATTTACGGTAGGTCTTAATGTTGATACTCGAGGGTACTTTTCTACTGCTACTATAGTAATTGCGGTCCCTACCGGGGTAAAGGTGTTTAGCTGACTAGCAACTATAGCGGGTAGTAAGTTTAAAATAAAGCCGGCTGCCTTTTGAAGGACAGGATTCTTGTTTTTATTTACTGTAGGGGGATTAACTGGGGTGATGTTGTCAAGTGCATCAATAGATGTGTCGCTTCATGATACCTATTACGTAGTAGCCCATTTCCACTATGTACTTAGAATAGGAGCTGTGTTTGGGGTTTTTTGTGGTTTAAACCACTGACTACCCAATTTTGTTGGAGTTTGCTTTAATAAGAAATGAAGGAAAGCCCATTTTATAGCTATATTTTTTGGAGTAAATACTACGTTTTTCCCACAACACTTTTTGGGGTTAAGAGGTATGCCACGGCGGTATATAGACTATGCTGATATTTATGCTCATTGGCATTGAGTGTCTTCATATGGGTCTGCTGTGTCATTTGGTTCTCTTATATACTTTAAGTTTTTACTCTGGGAAGCTTTAGTAAGCCAGCGAGGAGTAGTATTCAGTGGAGGCTTGTGTGGTGAAATAGATTGAGCTGGAACGCGAGATCTTTATCCAGGAAGAAAGCATGTGTACAGTCAACTTCCTTTTGTGTGGACTAATCCATATAATACGTGTATTACTTATATCTATAAGAAATCACGTAATCAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mytilus californianus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 62
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 16 specimens with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

California mussel

The California mussel, Mytilus californianus, is a large edible mussel, a marine bivalve mollusk in the family Mytilidae.

This species is native to the west coast of North America, occurring from northern Mexico to the Aleutian Islands of Alaska. California mussels are found clustered together, often in very large aggregations, on rocks in the upper intertidal zone on the open coast, where they are exposed to the strong action of the surf.

Contents

Shell description

The shell of this species is thick and is often 80 to 130 mm in length, sometimes larger still. The shell is blue on the outside with a heavy brown periostracum which is usually worn off except near the growing edge of the shell. The beaks of the shell are often eroded. The shell has coarse radial ribbing and irregular growth lines on the outer surface. The inner surface of the shell is blue and faintly pearly.

Like other mytilids, the animal is attached to the substrate with a very strong and elastic byssus.

Ecology

The California mussel prefers the high salinity, low sediment conditions found on open rocky coasts. However, they do not colonize bare rock easily, instead preferring the shelter of pre-existing mussels and their biological filaments. Mussels attach themselves to the hard surfaces using their thread-like byssus.

Given the right circumstances, California mussels can grow up to 200 mm (8 inches) in length and may live for more than 20 years. However, mortality in intertidal open coastal environments is often high, resulting from battering from driftwood and other debris, wave pounding, predation, desiccation, and disease. Predators of California mussels include the Pisaster starfish. Their most common food is Phytoplankton.

Human use

California mussels were an important food source for the Native Americans who lived on the Pacific Coast prior to European contact. On California's Northern Channel Islands, archaeological evidence shows that they were harvested continuously for almost 12,000 years. Erlandson et al. (2008) documented a decline in the average size of harvested California mussels on San Miguel Island during the past 10,000 years, a pattern they attributed to growing human populations and increased predation pressure from human fishing. Hogan (2008) notes more specific archaeological recovery from the Chumash in the period 800 to 1300 AD.

California mussels continue to be harvested as sources of both food and bait up and down the Pacific Coast of North America. The flesh of the California mussel tends to be orange in color. They can be baked, boiled, or fried like other mussels, clams, and oysters.

While these mussels are usually edible, care needs to be taken, because during times of red tide in any given locality, California mussels may contain harmful levels of the toxins which can cause paralytic shellfish poisoning.

In science

The keystone species concept was coined, in 1969,[1] by the zoologist Robert T. Paine, professor emeritus of the University of Washington, to explain the relationship between Pisaster ochraceus, a species of starfish, and Mytilus californianus.[2]

See also

References

Notes

  1. ^ "Keystone Species Hypothesis". University of Washington. Retrieved 2011-02-03. 
  2. ^ Stolzenberg, William (2009). Where the Wild Things Were: Life, death and ecological wreckage in a land of vanishing predators. Bloomsbury USA. ISBN 1-59691-299-5. 

Sources

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!