Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: This species is native to the Mediterranean but introduced to Texas and California (Roth and Sadeghian, 2003) and Louisiana (Fullington and Pratt, 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eobania vermiculata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ATTCGATTAGAGTTAGGGACATCCGGT---GTATTAACAGAT---GATCATTTTTACAATGTTATTGTTACCGCCCACGCATTTGTTATAATTTTTTTTATAGTTATACCTATTATGATTGGTGGATCTGGAAACTGGATAGTGCCTTTATTAATTGGTGCACCAGATATAAGCTTCCCTCGAATAAATAATATAAGTTTTTGATTACTACCTCCATCTTTCCTATTATTAATTAGTAGGAGTTTAGTAGAAGGGGGAGCAGGGACTGGGTGAACTGTATACCCACCTCTAAGAAGGTTAAGTGGACATAGTGGTGCTTCTGTAGACCTAGCTATTTTCTCTTTACATCTTGCTGGGATATCATCTATTTTGGGGGCTATTAACTTCATTACTACTATTTTTAATATGCGTTCACCTGGTGTAAGGTTAGAACGTATAAGGTTGTTTGTTTGGTCAATTTTAGTGGCTGTTTTTTTACCTTTATCATCGTTACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eobania vermiculata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is native to the Mediterranean but introduced to Texas and California (Roth and Sadeghian, 2003) and Louisiana (Fullington and Pratt, 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eobania vermiculata

Eobania vermiculata also known as Helix vermiculata, common name the "chocolate-band snail" is a species of large, air-breathing, land snail, a terrestrial pulmonate gastropod mollusk in the family Helicidae, the true snails or typical snails.

Eobania vermiculata is the type species of the genus Eobania.

Contents

Distribution[edit]

This species of large land snail is common in the Mediterranean area and it ranges from eastern Spain to the Crimea:

Nonindigenous distribution of Eobania vermiculata include:

  • This species has been introduced to southeastern Australia, where it is known as the chocolate-band snail.[4]
  • One individual of this snail species was found living on a wall in Lewisham, London, England, in 2006.[5][6] It remains to be seen if a colony will establish itself or not.

This species is already established in the USA, and is considered to represent a potentially serious threat as a pest, an invasive species which could negatively affect agriculture, natural ecosystems, human health or commerce. Therefore it has been suggested that this species be given top national quarantine significance in the USA.[7]

Description[edit]

The color of the shell is very variable, whitish to greenish yellow, often with colour bands or spots.[3] Lower side is frequently with two brown bands and whitish between lowest band and umbilicus.[3] The shell has 4-4.5 whorls.[3] The last whorl is descending abruptly below periphery.[3] The apertural margin is white, reflected in adult shells, in juveniles only at columellar side.[3] The umbilicus is narrow and open in juveniles, partly covered by the reflected columellar margin, completely closed in adult shells.[3]

The width of the shell is 22–32 mm.[3] The height of the shell is 14–24 mm.[3]

In northern Greece variation seems to be lower than in southern Greece (Gávdos island: 24.5-33.5 mm in diameter of adult shells, average 28–29 mm, with no local variations in shell size).[3]

Apical and apertural view of the shell of Eobania vermiculata.
Apical view of the shell of Eobania vermiculata
Five views of the shell of Eobania vermiculata

Juveniles differ from Theba pisana (with likewise umbilicus) by the larger size of the apex.[3]

Ecology[edit]

Eobania vermiculata live in a broad variety of habitats, usually in dry vegetation, mainly in coastal vicinity, also in agricultural crops.[3] It is very common in Crete, the species lives on practically every small island in the south Aegean.[3]

Drawing of love dart of Eobania vermiculata. Cross-section (on the left) and lateral view (on the right).

In northern Greece copulation takes place after the first rainfalls in autumn.[3] These snails create and use love darts as part of their mating behavior. Around 70 eggs per snail are laid 20 days later.[3] The size of the egg is 4.1 × 3 mm.[8] Juveniles hatch shortly after and grow about 12–13 mm in diameter per year for 2 years (growth is usually restricted to February to June in northern Greece, in Crete this period ends already in May).[3] Maturity is reached after 2 years when the diameter reaches 25 mm, the umbilicus becomes closed and the apertural margin becomes reflected.[3] Snails reach 29–30 mm diameter in May/June of the second year in northern Greece (in April in Crete), reaching a maximum diameter (33 mm) may take 5 years or more, but mortality increases greatly after 2 years.[3]

About 20% of the snails in a population survive to lay eggs in the 3rd year, 5% of the snails lay eggs again in the 4th year.[3] The mortality rates decrease with age.[3] The animals hibernate (in northern Greece) or aestivate (in Crete), but juveniles and adults show differences in their behaviour.[3] Adults dig into the soil and build an epiphragm, while juveniles search protected places under stones or leaves of low plants.[3]

A group of Eobania vermiculata from Tunisia

Human use[edit]

The species is commercialized and exported from Greece to France, which led Lazaridou-Dimitriadou & Kattoulas (1981)[9] to propose restrictions for size and seasons of collection.[3]

References[edit]

This article incorporates public domain text from the reference.[3]

  1. ^ Müller O. F. (1774). Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non-marinorum, succincta historia. Volumen alterum. pp. I-XXVI [= 1-36], 1-214, [1-10]. Havniae & Lipsiae. (Heineck & Faber).
  2. ^ a b Commonwealth of Australia. (April 2002). "Citrus Imports from the Arab Republic of Egypt. A Review Under Existing Import Conditions for Citrus from Israel". Agriculture, Fisheries and Forestry, Australia. Caption: Gastropods, page 12 and Appendix 2.
  3. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa "Species summary for Eobania vermiculata". AnimalBase. Last modified 31 August 2010, accessed 13 October 2010.
  4. ^ Eobania vemiculata. accessed 4 November 2008.
  5. ^ Notton D. (2006). "Eobania vermiculata in the UK". Mollusc World 11: 6.
  6. ^ JRS (December 2006). "Aliens: what can they teach us?". The Archeo+Malacology Group Newsletter (10): page 7.
  7. ^ Cowie R. H., Dillon R. T., Robinson D. G. & Smith J. W. (2009). "Alien non-marine snails and slugs of priority quarantine importance in the United States: A preliminary risk assessment". American Malacological Bulletin 27: 113-132. PDF.
  8. ^ Heller J. (2001). Life History Strategies. In: Barker G. M. (ed.) The biology of terrestrial molluscs. CABI Publishing, Oxon, UK, 2001, ISBN 0-85199-318-4. 1-146, cited page: 428.
  9. ^ Lazaridou-Dimitriadou M. & Kattoulas M. (1981). "Contribution a l'étude de la biologie et de la croissance des escargots commercialisés en Grèce: Eobania vermiculata (Müller) et Helix aspersa Müller". Haliotis 11: 129-137.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!