Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Distribution

The northern distribution boundary of Cepaea nemoralis is in Scotland and southern Scandinavia. The range extends south to the Iberian Peninsula and Croatia in the south. Capaea nemoralis is found in the western and eastern coasts of both Ireland and the UK, Belgium, and France. The eastward distribution extends to the northwestern areas of Poland. This species was introduced in southeastern Poland, where it currently thrives. Cepaea nemoralis was introduced into North America during the nineteenth century and is currently found in Virginia, New York, Ontario, and Massachusetts.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species is widespread in Europe, and is locally abundant (Kerney, Cameron and Jungbluth 1983).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species is native to western Europe but have been introduced widely including many places in the U.S. and Canada (Whitson, 2005; Burch, 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cepaea nemoralis has a yellow, pink, or brown shell. The shell contains as many as five dark bands (each 360 degree revolution constitutes one band). The shells are made up of different layers. The outer layer (periostracum) is made up of conchiolin and the layer directly layer is much thicker and is composed of calcium carbonate. Calcium is an important component of the shell and it is an important factor that determines the shell strength. Calcium concentrations vary from 319 to 359 mg/g. The shell strength, measured in Newtons required to break it, varies from 35 to 63 N. Cepaea nemoralis shell thickness varies from 0.17 to 0.21 mm. The dry weight of the shell varies from 0.43 to 0.72 g. The shell volume measures anywhere from 2230 to 3012 cubic mm.

Range mass: 0.72 (high) g.

Range basal metabolic rate: 0.014 to 0.251 cm3.O2/g/hr.

Average basal metabolic rate: 0.134 cm3.O2/g/hr.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Cepaea nemoralis is found in habitats ranging from hedgerows to downland turf and from beech woods to sand dunes near the sea. This species is also found throughout grasses and herbs. A relatively small amount is found in Marram grass. Unbanded and yellow C. nemoralis are mostly found in open habitats. Colonies with a green background have a high proportion of yellow C. nemoralis. Yellow C. nemoralis can also be found in shaded areas and banded shells of this species are found in areas of hedgerows and mixed rough herbage. In areas where the type of land is discontinuous, branded C. nemoralis are found. In Southeastern Poland, where C. nemoralis has been introduced, the species is found in urban environments where it inhabits gardens, orchards, cemeteries, hedgerows and other vegetation made up of herbs. In the hot and dry months of the summer, C. nemoralis is also found in tall plants and plants with large leaves or stems. Two of these plants include goldenrod and Centaurea. During hibernation C. nemoralis are found underground on land and underwater where they can survive for 2-3 weeks.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: urban

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
In Ireland, it is found mostly in shaded, rocky or humanly disturbed habitats such as gardens. It can be sparsely distributed on acid soils where shells are thin and fragile. It is most abundant and well developed on coastal dunes and generally prefers sheltered dry places (Byrne et al. 2009).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cepaea nemoralis prefers to eat dead plant material rather than fresh. They also prefer to eat herbs rather than grasses. Adult C. nemoralis show greater selectivity in their eating habits than the juveniles, although they eat some grasses while juveniles do not. They eat Poterium sanguisorba and Leontodon hispidus. Lotus corniculatus and Urtica diocia are examples of rarely consumed greens. Cepaea nemoralis avoid vetch, shrub and grass in their diet. Remains of ants, beetles, spiders, mites, springtails and aphids are found in the diet of C. nemoralis, but these are probably the remains that were eaten along with greens and herbs.

In a colony that is as dense as 5 adults per square meter, the mean annual biomass consumed is 1.03 g per square meter. A large C. nemoralis can eat 125 mg of food per week, meaning a daily consumption rate of 59.5 mg of food per 1 g of dry tissue weight of the snail. Cepaea nemoralis relies on large lumps of food and its hydrolytic enzymes in its gut for nutrition. Vitamins A and B and some sterols are required components of C. nemoralis nutrition. Adults require sitosterol, a plant sterol.

Animal Foods: insects

Plant Foods: leaves; wood, bark, or stems; fruit; flowers

Primary Diet: herbivore (Folivore , Frugivore , Lignivore)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Phorid flies are parasitic on C. nemoralis.

Ecosystem Impact: biodegradation

Commensal/Parasitic Species:

  • Phorid flies, Phoridae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Birds, mice, and rats are the most significant predators of Cepaea nemoralis. In Europe, the most common predator of C. nemoralis is song thrushes. Predators feed on snails by cracking the shells on nearby hard objects or with the use of their teeth.

Other predators of C. nemoralis include the rook, the brown rat, hedgehogs, moles, field mice, Sorex, rabbits, and maggots. Phorid flies are parasitic and consume C. nemoralis.

Anti-predator adaptations of C. nemoralis include the complexity of color and bands on shell varying with the complexity of the landscape, known as background matching. Brown shelled C. nemoralis are found in landward parts which are generally complex landscapes. Unbanded shells are found in the most pitted areas. The greatest complexity in the variation of shell colors and whether or not the shells are un/banded correlates with the amount of enclosed spaces such as pits that serve as amphitheaters for other organisms. Song Thrushes, a main predator of C. nemoralis, preys on shells that are distinguishable from the environment.

Another anti-predator adaptation of C. nemoralis is shell thickening. Thickening of the shell prevents the ability of a predator to crush the shell. It also increases the "handling time" of the snail. Increasing handling time makes C. nemoralis less energetically rewarding prey. Crushing resistance positively correlates with calcium concentration.

Known Predators:

  • Song thrush, Turdus ericetorum
  • Rook, Corvus frugilegus
  • Brown rat, Rattus norvegicus
  • Hedgehog, Erinaceus europaeus
  • Moles, Talpidae
  • Field mouse, Apodemus sylvaticus
  • Rabbits, Leporidae
  • Maggots
  • Phorid flies, Phoridae

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Cepaea nemoralis (snail carrion (Cepaea nemoralis)) is prey of:
Psychoda humeralis
Spiniphora maculata
Megaselia brevicostalis
Megaselia tenebricola
Piophila vulgaris
Neoleria maritima
Leptocera luteilabris
Sphaerocera vaporariorum
Sarcophaga hirticrus
Sarcophaga nigriventris
Sarcophaga teretirostris
Muscina assimilis
Fannia canicularis
Hydrotaea occulta
Subhylemyia longula
Lasiomma octoguttatum
Craspedochoeta pullula

Based on studies in:
Wales (Forest, Plant substrate)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: In New York, Hotopp and Pearce (2007) report it from four counties in the metro and Long Island area and on Lake Erie. It was introduced intentionally to Frederick Co., Maryland (Grimm, 1971) and is still present there today (Orstan and Pearce, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Cepaea nemoralis is able to respond to painful and non-painful stimuli. During the night, C. nemoralis feels more pain. Calcium channels are involved in the regulation of neuronal functions in mollusks in a manner like vertebrates. Similar intermediary messenger systems also exist between Cepaea and rodents.

Cepaea nemoralis predominantly moves in an upwind direction. They first randomly move in any direction before following the upwind stream. The decision to move upwind is made when the odor of favored foods is detected.  Interactions between C. nemoralis exist. As the number of individuals within a colony increases, there is a decline in juvenile growth rates and birth rates. Limited resources is not the explanation because even in areas of normal competition, there is still growth rate and birth rate declines. This indicates that there is either a chemical or behavioral type of communication within the species that is responsible for the declination.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual ; infrared/heat ; tactile ; chemical ; magnetic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

In Europe, from 30-80 eggs (2.3-3.0 mm in diameter) are laid and hatch in 15-20 days. High temperatures and low humidity reduce the snail's activity and therefore inhibits growth rate. Cepaea nemoralis can form the peristome lip, which indicates it is an adult, in one active season. Juveniles may take to three years to develop into adults.

The color variation in the shells of Cepaea nemoralis is determined genetically by allelic series. Yellow shell alleles are recessive to pink shell alleles, and both yellow and pink shell alleles are recessive to brown shell alleles. The unbanded shell allele is dominant to banded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Cepaea nemoralis may live up to six years in the wild, but this is uncommon because of predation. In captivity, they may live up to 10 years. The average lifespan of C. nemoralis is 2.3 years. The survival rates of the young greatly differs and can range anywhere from 0.3 to 0.7. However, in most cases, the rate is closer to 0.3. It depends on the region and the temperature.

Range lifespan

Status: wild:
6 (high) years.

Average lifespan

Status: wild:
2.3 years.

Range lifespan

Status: captivity:
10 (high) years.

Average lifespan

Status: wild:
2.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Cepaea nemoralis is hermaphroditic and mates more than once. A mating partner for C. nemoralis is random, according to color, size and banding patterns. The snails can store sperm for long periods of time. Each individual C. nemoralis may produce offspring from several matings in each brood. The average number of mates per brood is two. Cross fertilization is obligatory.

The offspring of each C. nemoralis is divided into a number of broods that is produced over a period of months or even years. This makes it unlikely that the fates between different broods will mimic each other. Each brood consists of genetic contributions from one female parent and two male parents. This reduces the dependence of single parents for survival within a whole brood unit. This system of multiple mating and sperm storage protects organisms that are minimally mobile from complete fatality within a gene pool.

Courtship of C. nemoralis is elaborate. A calcareous dart is jabbed into a potential partner before mating begins. In order to prevent accidental mating between C. nemoralis and a closely related species, Cepaea hortensis, the two species have different darts.

Mating System: polygynandrous (promiscuous)

The breeding interval of Cepaea nemoralis runs from April through October. The relative seasons are spring, summer and the beginning of the fall. The number of offspring per brood is around 23. Eggs are laid simultaneously in a dug nest in soil. The snail's foot is used to create a cavity in soil for laying eggs. The laying of the eggs can take up to three days and when complete, its foot is used again to cover the nest.

The average number of hatched young per year is 33. The eggs of one brood may survive or die as a unit; however, once they hatch, the individual's survival is not correlated to the rest of the brood. High temperatures and low humidity reduce the snail's activity and therefore inhibits growth rate and egg production.

Breeding interval: This species breeds 1 to 2 times yearly.

Breeding season: Breeding season is from April to October.

Average number of offspring: 23.

Range age at sexual or reproductive maturity (female): 1 to 2 weeks.

Range age at sexual or reproductive maturity (male): 1 to 2 weeks.

Key Reproductive Features: seasonal breeding ; sequential hermaphrodite; sexual ; induced ovulation ; fertilization (Internal ); oviparous ; sperm-storing ; delayed fertilization

Cepaea nemoralis produces eggs at the same time and are laid in nest they dig and cover up with soil. Beyond hatching, there is no parental care.

Parental Investment: male parental care ; female parental care ; pre-fertilization

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cepaea nemoralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGCGATGATTTTTTTCCACTAACCACAAAGATATTGGGACTTTGTATATACTTTTTGGTATTTGATGCGGATTTGTTAACAGTGGCTTATCTCTGTTAATTCGCTTGGAACTGGGAACAGCAGGAGTACTAACAGACGACCATTTTTACAACGTAATTGTAATGTACGCTCATGCATTGTATGATCTTTTTATGGTTATGCCAATTATAATTGGTGGTTTTGGCAATTGGATAGTCCACTGCTTGTGGAGCTCCGATATGAGCTTTCCTCGAATGAACAATCTTAGCTTCTGACTGTTACCTCCTTCCTTTCTACTATTAATTAGCAGCAGTCTAGTGGAAGGCGGTGCTGGTACAGGTTGGACAGTATACCCTCCTCTTAGGAGTCTAGTCGGTCATAGAGGTGCGTCTGTTGATTTAGCCATTTTTTCCTTACATTTAGCAGGTGTCTCTTCAATTTTGGGGGCTATTAATTTTATTACTACAATTTTTAATATACGTGCCCCTGGCTTAACAATGGAACGCCTCAGCTTGTTTGTAGTGATCTATTCTAATTACTGTATTTTTCTTCTTTTGTCTCTTCCAGTCCTCGCGGGTGCCATTACGATATTATTAACAGATCGAAACTTTAATACGTCGTTTTTTGATCCGGCAGCGGGGGATGATCCAATTCTTTACCAACACTTGTTTTGATTTTTTGGTCACCCCGAAGTATATATTTTAATCTTGCCAGGTTTCGGTATTGTTTCACATATTTTAGGCAACTACAGGATTAAGCCGCCTTTCGGTACTTTGGGTATAATTTATGCAATAATTTCAATCGGCGTATTAGGTTTATGTCTGAGCCATCACATATTCACTGTTGGGATAGATGTTGACACGCGTGCTTATTTTACAGCCGCTACGATAGTATTTGCTGTTCCAACGGGGATTAAAGTGTTTAGTTGACTTATGACCATTTATGGATTTAAGCACAAGTTAGATGCAGCTATGTACTGAGTTTTAGGATTCATTTTTTTATTCACTTTGGGGGGATTAACAGGTATTGTACTTTCAAACGCGTCTCTTGACATCATACTGCACGACACATATTACGTTGTTGCTCATTTTCATTATGTACTTTCAATAGGTGCTGTGTTCGCTATTTTTGCCGGGTTTATTTTTGATTCCCTTGTTATAACAGGACTTGCGATTAATGACTTATTTGCAAAATGTCAATTTTTTGTCATGTTTGCAGGTGTAAACCTAACTTTTTTTCCACAACATTTTTACGGTCTAGCTGGAATGCCCCGGCGGTATAGGGATTACCCAGACGCTTACTACGGCTGAAACCAAGTTTCCTCAATTGGCTCGCTGATTAGTGTTTTCGCCGTTTTGATGTTTATTTTACTTGTGTGGGAAGCCTTACTTGCGCAGCGGCCCTACGTATTTTCAGAGACTGCTACTTATGCTCGTGAATGGGAAGCTGGTTTGCCCCCTGACTTTCATGGCAACTTAGAGACATCAGCTGTTGTATCTGCTTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cepaea nemoralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Cepaea nemoralis is listed as "least concern" in the Czech Republic. It is not specially listed by any other countries or organizations.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
Neubert, E.

Reviewer/s
Cuttelod, A. & Bilz, M.

Contributor/s

Justification

This species is relatively widespread and there is no threat known to this species. It is therefore considered to be Least Concern (LC).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is native to western Europe but have been introduced widely including many places in the U.S. and Canada (Whitson, 2005; Burch, 1962).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

The size and trend within the subpopulations are supposed to be stable. In Ireland, it is frequent throughout but most abundant in coastal localities, particularly dune (Byrne et al. 2009).


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

There are no major threats to this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In Ireland, this species is listed as Least Concern (Byrne et al. 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse affects of Cepaea nemoralis on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cepaea nemoralis display a significant amount of polymorphism in their shells. This polymorphism has been the subject of many evolutionary studies in Europe.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grove snail

The grove snail or brown-lipped snail (Cepaea nemoralis) is a species of air-breathing land snail, a terrestrial pulmonate gastropod mollusc. It is one of the most common species of land snail in Europe and has been introduced to North America.

Cepaea nemoralis is the type species of the genus Cepaea.[3]

It is used as a model organism in citizen science projects.[4]

Description[edit]

Cepaea nemoralis is among the largest and, because of its polymorphism and bright colours, one of the best-known snails in Western Europe.[4] The colour of the shell of Cepaea nemoralis is very variable; it can be reddish, brownish, yellow or whitish, with or without dark brown colour bands.[5] Apertural lip usually dark brown, rarely white.[5] The umbilicus is narrow but open in juveniles, and closed in adults.[5] For every colour variant names were established in the 1800s; this system was later abandoned.[5] The surface of the shell is semi-glossy, and it has from 4½ to 5½ whorls. The width of the shell is 18–25 mm.[5] The height of the shell is 12–22 mm.[5]

Identification[edit]

The similar species Cepaea vindobonensis is less intensely coloured.[5] The grove snail is closely related to the white-lipped snail, C. hortensis, shares much the same habitat, and has similar shell colour and pattern.[5] The grove snail is usually the larger of the two species when mature, but the principal difference is that the adult grove snail almost always has a dark brown lip to its shell, whilst adults of Cepaea hortensis almost always have a white lip.[5] However, a morph of the grove snail also has a white lip. In areas where lip colour is variable, dissection is necessary: the structure of the love dart is quite different in the two species, as are the vaginal mucus glands. A cross-section of the love dart shows a cross with simple blades, whereas that of C. hortensis has bifurcated blades.[5] C. hortensis has 4 or more branches of body light with reddish or brownish hue, upper side often slightly darker, tentacles darker and 15 mm long.[5]

Coloration[edit]

Apart from the band at the lip of the shell, grove snails are highly polymorphic in their shell colour and banding. The background colour of the shell can sometimes be so pale as to be almost white; it can also be yellow, pink, chestnut through to dark brown, and the shells can be with or without dark bandings. The bands vary in intensity of colour, in width and in total number, from zero up to a total of six.

The polymorphism has been intensely studied from 1940 onwards for its heredity, evolution and ecology. Researchers have variously asserted that the cause is random genetic drift, different natural selection pressures in different areas (the snail often has darker camouflage in woodland, lighter in rough grassland) with mixing by migration, and balanced polymorphism. Balanced polymorphism could arise when a predator like the Song Thrush has a given 'search image', so it tends to see and kill snails of a particular colour and pattern. Natural selection would then favour a diversity of colours and patterns as an antipredator adaptation. However it appears that no one explanation is the whole answer: most probably, the polymorphism has several causes, including selection of paler, more reflective colours in hot environments to reduce water loss.[6]

Different coloration and banding of the shells of Cepaea nemoralis:

Distribution[edit]

Cepaea nemoralis

The native distribution of this species is from northern and western Europe to central Europe,[7] including Ireland[5] and Great Britain. The species is rare and scattered in northern Scotland, where it has been introduced.[5] It is not found in the Hebrides, Orkney or Shetland.[5] It seems to have been affected by air pollution and soil acidification in some parts of England.[5]

The species is found in France, Netherlands, Switzerland, Austria, Germany, eastwards to northwestern Poland,[5] Czech Republic,[8] SW Hungary,[5] southern Portugal,[5] central Spain,[5] Bosnia,[5] in Italy to Lucania,[5] and as far north as southern Sweden.[5] In Eastern Europe it is found in Latvia,[5] Kaliningrad,[5] Estonia (Hiiumaa island),[5] and Ukraine.[9]

No doubt aided by human transport, this species is a good colonizer, and is often found in gardens, parks and abandoned land in cities.[4] In Eastern Europe it occurs in urban areas. More recently, the grove snail has been introduced to North America,[5] and Venezuela.

The white-lipped snail has a similar range, but that species extends further north, to border the Arctic.

Ecology[edit]

Mating
Love dart of Cepaea nemoralis
Broken shells of grove snails on a Song Thrush 'anvil'

This is a very common and widespread species in Western Europe, occupying a very wide range of habitats from dunes along the coastline, to woodlands with full canopy cover.[4] It lives in shrubs and open woods, in plains and highlands, dunes, cultivated habitats, gardens and roadsides.[5] It can be found up to an altitude of 1200 m in the Alps, 1800 m in the Pyrenees, 900 m in Wales, 600 m in Scotland.[5]

This species feeds mainly on dead or senescent plants.[4][5] It is not noxious to crops.[5]

Like most Pulmonate land snails, it is hermaphrodite and must mate to produce fertile eggs.[4] Mating tends to be concentrated in late spring and early summer, though it can continue through the autumn.[4] The snails often store the sperm they receive from their partner for some time, and individual broods can have mixed paternity.[4] In Britain it lays clutches of 30-50 (in France 40-80) oval eggs are laid between June and August (in France May–October, in W France until November).[5] The size of the egg is 3.1 × 2.6 mm[10] or egg diameter can be 2.3-3.0 mm.[5] Juveniles hatch after 15–20 days.[5] Maturity is reached when the shell reaches full adult form, which in France is after one year.[5]

This snail is comparatively slow-growing, usually taking three years to develop from an egg to a breeding adult.[4] The life-span for this species is up to seven or eight years, with annual survival rates of about 50% (= 3% in five years, older adults suffer higher mortalities).[5] In winter, the snails may hibernate, but can become active again during warm spells.[4]

Parasites:

Predators of Cepaea nemoralis include the Song Thrush Turdus philomelos and others.

References[edit]

This article includes public domain text from the reference[5] and CC-BY-2.5 text from the reference[4]

  1. ^ 2013 IUCN Red List of Threatened Species. <www.iucnredlist.org>. Cited 28 December 2013.
  2. ^ Linnaeus C. (1758). Systema naturae per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. pp. [1-4], 1-824. Holmiae. (Salvius).
  3. ^ "Genus summary for Cepaea". AnimalBase, last modified 23 December 2008, accessed 1 May 2011.
  4. ^ a b c d e f g h i j k Silvertown J., Cook L., Cameron R., Dodd M., McConway K. et al. (2011). "Citizen Science Reveals Unexpected Continental-Scale Evolutionary Change in a Model Organism". PLoS ONE 6 (4): e18927. doi:10.1371/journal.pone.0018927. 
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai aj "Species summary for Cepaea nemoralis". AnimalBase, last modified 6 February 2011, accessed 1 May 2011.
  6. ^ Cain, A.J. and Sheppard, P.M. (1954). "Natural Selection in Cepaea". Genetics 39 (1): 89–116. PMC 1209639. PMID 17247470. 
  7. ^ Dvořák L., Honěk A. & Martínková Z. (2003). "The spread of Cepaea nemoralis (L.) populations in the Czech Republic". 2003 BCPC Symposiumproceedings No. 80: Slugs & snails: agricultural, veterinary & environmental perspectives: 99-102.
  8. ^ Juřičková L., Horsák M., Beran L. (2001). "Check-list of the molluscs (Mollusca) of the Czech Republic". Acta Soc. Zool. Bohem. 65: 25–40. 
  9. ^ Balashov I., Gural-Sverlova N. (2012). "An annotated checklist of the terrestrial molluscs of Ukraine". Journal of Conchology 41 (1): 91–109. 
  10. ^ Heller J. (2001). Life History Strategies. In: Barker G. M. (ed.). The biology of terrestrial molluscs. CABI Publishing, Oxon, UK, ISBN 0-85199-318-4. 1-146, cited page: 428.
  11. ^ Conboy G. A. (30 May 2000). "Canine Angiostrongylosis (French Heartworm)". In: Bowman D. D. (Ed.) Companion and Exotic Animal Parasitology. International Veterinary Information Service. Accessed 24 November 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!