Overview

Brief Summary

Biology

This snail is mainly nocturnal but will emerge after rain during the day. It moves by means of a muscular foot; the mucus secreted by the foot aids with movement and leaves a tell-tale track behind. They feed on a range of plant matter, and can be serious pests of gardens (4). This snail has a strong homing instinct, and spends the day, often in large groups, beneath stones and other structures. They hibernate through the winter in similar locations (5). Garden snails are hermaphrodites, meaning that one individual possesses both male and female reproductive organs; although they are able to self-fertilise, most snails mate with another snail (4). Reproduction takes place in early summer, and begins with pairing and courtship. After a period in which the members of the pair caress each other with their tentacles, each snail pierces the skin of its partner with a calcareous 'love dart', a spiny projection which is covered in mucus. The function of this love dart is unclear, but it is thought that the mucus may act to improve the survival of sperm. Mating then takes place; each snail inserts its penis into its partner at the same time (6). The snails separate, and the sperm is stored internally until the eggs are ripe. After the eggs have been fertilised, the snails dig pits in the soil in which to lay the eggs (5). Hatchlings have translucent, delicate shells (4). The garden snail is edible, and snail farming is currently a booming cottage industry in Britain. This species has also been used for centuries in traditional medicine, for example, broth made from the mucus was used to treat sore throats (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This snail is very common and widespread, and is the typical garden snail (1). The shell is generally spherical in shape with a short spire and a 'wrinkled' surface (3). It is pale brown, or yellow in colour (3), and is marked with a number of broken dark bands that give the shell a blotched appearance (2). The thickened lip around the large opening, or 'aperture' of the shell is white in colour (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Cette espèce fait l'objet d'un projet de sciences participatives en relation avec l'INPN et mené en partenariat avec Noé Conservation (www.biodiversite-foret.fr).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This European species has been widely introduced around the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 According to Valdovinos (1999) this species has records in Chile from La Serena (29°54'S, 71°15'W) to the Chiloé Island, and the Juan Fernandez Archipelago (33°38'S, 78°84'W). This is the northernmost record of this species in Chile and it is the only introduced land snail species found in the area.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Juan Francisco Araya, Ricardo Catalán

Source: ZooKeys

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The garden snail is found throughout most of lowland Britain (1). Elsewhere, it has a wide distribution, and is found across the Mediterranean area, in parts of western Europe, North Africa, and Asia Minor (2). It has also been widely introduced, and has become established in some areas of the USA (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Terrestrial

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Very often associated with humans, and can be found in parks and gardens. It also inhabits woods, hedgerows and dunes (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Cryptobia helicis endoparasitises spermatheca of Helix aspersa

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Hubricht (1953) lists vacant lots in Norfolk, Norfolk Co., Virginia. It has also been reported by Pilsbry (1939) from Charleston, South Carolina, Baton Rouge and New Orelans, Louisiana, and numerous areas in coastal southern California. Inland reports include Santa Fe, New Mexico (Cockerell, 1936), Shreveport, Louisiana (Branson, 1961), and Boulder, Colorado (McCoy and Nelson, 1962). It was first introduced to Hawaii in 1952 and 1956 in Oahu, on the Island of Hawaii in 1976, and from Maui (Kula) in 1981 (Cowie, 1996). A new record was found in Virginia in the city of Chincoteague, Accomack Co. (Orstan, 2008). Previous Virginia records include "near Virginia City" in 1924 (Dundee, 1974), Norfolk in 1943 (Hubricht, 1971), and in Chesapeake Co. (Beetle, 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Mucus takes on adhesive qualities: dusky arion slug
 

Mucus of slugs and land snails takes on adhesive characteristics with the addition of certain proteins.

     
  "Researchers from Ithaca College and Cornell University studied the mucus and gel of land snails. Several molluscs have been shown to alternate between a non-adhesive trail mucus and a similar gel that forms a strong glue. The major structural difference between the two secretions is the presence of specific proteins in the adhesive mucus. This study identifies similar proteins from the glue of the slug Arion subfuscus and the land snail Helix aspersa. To investigate the role played by these proteins in adhesion, the proteins were isolated from the adhesive mucus of different molluscs and added to commercial polymer solutions. The effect was observed qualitatively, and quantified using a dynamic rheometer. The isolated proteins triggered gelling or visible stiffening of agar, pectin and polygalacturonic acid. The effect was stronger on more negatively charged polymers. The effect of the proteins was concentration dependent with an optimal concentration of 1–1.5 mg per ml, and was weakened when their structure changed. Other proteins and carbohydrates found in the adhesive mucus had no clear mechanical effect on gels. These findings show that the addition of these proteins to large, anionic polymers plays a central role in the formation of a glue from a mucus-like secretion. Such a mechanism may be common among invertebrates, and it may guide biomimetic approaches in the development of glues and gels." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
  • Pawlicki, J. M.; Pease, L. B.; Pierce, C. M.; Startz, T. P.; Zhang, Y.; Smith, A. M. 2004. The effect of molluscan glue proteins on gel mechanics. Journal of Experimental Biology. 207: 1127-1135.
  • Bradshaw A; Salt M; Bell A; Zeitler M; Litra N; Smith AM. 2011. Cross-linking by protein oxidation in the rapidly setting gel-based glues of slugs. The Journal of Experimental Biology. 214: 1699-1706.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Helix aspersa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CGTTTTGAATTAGGTACATCAGGT---GTATTAACTGAT---GATCATTTTTATAATGTTATTGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGCGGTTTTCCGCGTATAATAGTACCTTTATTAATTGGTGCTCCAGATATAAGATTTCCGCGTATAAATAATATAAGGTTTTGATTATTACCCCCTTCCTTCCTCCTCCTGATTAGTAGGAGCTTAGTANAAGGTGGTGCTGGAACTGGTTGAACTGTATATCCCCCATTAAGAAGTCTAAGAGGTCATAGTGGTGCATCTGTCGATTTAGCTATTTTTTCATTACATCTTGCTGGTATATCCTCAATTTTAGGGGCTATTAATTTTATTACTACAATTTTTAACATACGTTCACCGGGCATTAGATTAGAACGCATAAGATTATTTGTTTGGTCTATTTTAGTGACTGTTTTTTTATTACTACTATCATTACCCGTTTTAGCAGGTGCTATTACTATATTATTAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Helix aspersa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cornu aspersum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This European species has been widely introduced around the world.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cornu aspersum

Cornu aspersum, known by the common name garden snail, is a species of land snail. As such it is a terrestrial pulmonate gastropod mollusc in the family Helicidae, which include the most commonly familiar land snails. Of all terrestrial molluscs, this species may well be the most widely known. In English texts it was classified under the name Helix aspersa for over two centuries, but the prevailing classification now places it in the genus Cornu.

Cornu aspersum is native to the Mediterranean area and western Europe, but whether deliberately or accidentally, humans have spread it to temperate and subtropical areas world wide. The snail is relished as being edible, but it is widely regarded as a pest in gardens and in agriculture, especially in regions where it has been introduced accidentally and where snails are not eaten as a rule.

Description[edit]

Cornu aspersum in warm regions commonly emerges in moist weather in winter.
Sinistral form (exceptional) and dextral form (common) MHNT

The adult bears a hard, thin calcareous shell 25–40 mm in diameter and 25–35 mm high, with four or five whorls. The shell is variable in color and shade but generally is dark brown, brownish golden, or chestnut with yellow stripes, flecks, or streaks (characteristically interrupted brown colour bands).The aperture is large and characteristically oblique, its margin in adults is white and reflected.

The body is soft and slimy, brownish-grey, and the animal retracts itself entirely into the shell when inactive or threatened. When injured or badly irritated the animal produces a defensive froth of mucus that might repel some enemies or overwhelm aggressive small ants or the like. It has no operculum; during dry or cold weather it seals the aperture of the shell with a thin membrane of dried mucus; the term for such a membrane is epiphragm. The epiphragm helps the snail retain moisture and protects it from small predators such as some ants.

The snail's quiescent periods during heat and drought are known as aestivation; its quiescence during winter is known as hibernation. When hibernating, Cornu aspersum avoids the formation of ice in its tissues by altering the osmotic components of its blood (or haemolymph); this permits it to survive temperatures as low as -5°C (23°F).[3] During aestivation, the mantle collar has the ability to change its permeability to water.[4] The snail also has an osmoregulatory mechanism that prevents excessive absorption of water during hibernation. These mechanisms allow Cornu aspersum to avoid either fatal desiccation or hydration during months of either kind of quiescence.

During times of activity the snail's head and "foot" or "belly" emerge. The head bears four tentacles; the upper two are larger and bear eye-like light sensors, and the lower two are tactile and olfactory sense organs. The snail extends the tentacles by internal pressure of body fluids, and retracts all four tentacles into the head by invagination when threatened or otherwise retreating into its shell. The mouth is located beneath the tentacles, and contains a chitinous radula with which the snail scrapes and manipulates food particles.

Taxonomy[edit]

Between 1774 and 1988 all authorities accepted the species as a member of the genus Helix. However, in a number of publications since 1990,[5] it has been placed in one of three other genera, depending on the classification in relation to Helix aperta and on the accepted interpretation of the ICZN Code's Article 1.3.2 on the Cornu problem.[6][7] For those who regard Cornu as appropriate, the name can be Cornu aspersum if they prefer not to classify it in Helix.[8][9][10] Those who prefer neither Cornu nor Helix, fall into two camps; if they classify Helix aperta in the same genus as Helix aspersa, as was done by Italian research teams and others,[11] then they assign this species to Cantareus aspersus; [12][13][14] Other workers, such Ukrainian and Russian research teams who regard the two species as being in different genera, call it Cryptomphalus aspersus.[15][16][17][18] The matter still is subject to resolution.

Life cycle[edit]

Like other Pulmonata, Cornu aspersum is a hermaphrodite, producing both male and female gametes. Reproduction is usually sexual, although self-fertilisation sometimes occurs.[19] During a mating session of several hours, two snails exchange sperm. Cornu aspersum is one of the species that uses love darts during mating.

About two weeks after fertilisation, the snail lays a batch of about 80 spherical pearly-white eggs into crevices in the topsoil or sheltered under stones or the like. In a year it may lay six batches or so.[20] The size of the egg is 4 mm.[21]

The young snails take one to two years to reach maturity.[22] In some regions snail farms produce them commercially.

Distribution[edit]

A hibernaculum on a doocot in Eglinton, Scotland

Cornu aspersum is native to the Mediterranean region (including Egypt[23]) and western Europe, from northwest Africa and Iberia, eastwards to Asia Minor, and northwards to the British Isles.

About the beginning of the 20th century, a number of North African endemic forms and subspecies were described on the basis of shell characteristics. The commonest subspecies, Cornu aspersum aspersum (synonym Helix aspersa aspersa), has become very abundant, mainly in agricultural and residential human habitats where the climates is temperate, Mediterranean, or subtropical.[24]

Cornu aspersum is a typically anthropochorous species; it has been spread to many geographical regions by humans, either deliberately or accidentally. Nowadays it is cosmopolitan in temperate zones, and has become naturalised in many regions with climates that differ from the Mediterranean climate in which it evolved.[25][22] It is present on all continents except Antarctica, and occurs on most major islands as well. Its passive anthropochory is the likeliest explanation for genetic resemblances between allopatric populations. Its anthropochorous spread may have started as early as during the Neolithic revolution some 8500 BP. Such anthropochory continues, sometimes resulting in locally catastrophic destruction of habitat or crops.[24]

Its increasing non-native distribution includes other parts of Europe, such as Bohemia in the Czech Republic since 2008.[26] It is present in Australia, New Zealand, North America and southern South America.[27] It was introduced to Southern Africa as a food animal by Huguenots in the 18th century, and into California as a food animal in the 1850s; it is now a notorious agricultural pest in both regions, especially in citrus groves and vineyards. Many jurisdictions have quarantines for preventing the importation of the snail in plant matter.[28]

Ecology[edit]

Hundreds of Cornu aspersum on a wall
Female glowworm beetle, family Lampyridae, feeding on a specimen of Cornu aspersum that it has killed with its venomous bite.
C. aspersum shell cemetery. Individuals failing to overwinter in Scotland.

Cornu aspersum is a primarily a herbivore with a wide range of host plants. It feeds on numerous types of fruit trees, vegetable crops, garden flowers, and cereals. It also is an omnivorous scavenger that feeds on rotting plant material and on occasion will scavenge animal matter, such as crushed snails and worms. In turn it is a food source for many other animals, including small mammals, many bird species, lizards, frogs, centipedes, predatory insects such as glowworms in the family Lampyridae, and predatory terrestrial snails.[29] The species may on occasion be of use as an indicator of environmental pollution, because it deposits heavy metals, such as lead in its shell.[30]


Parasites[edit]

Parasites of Cornu aspersum include:

Behavior[edit]

Cornu aspersum leaving mucus-conserving trail over dry brick. The belly visibly leaves the ground in two places in a wave motion without dragging. That wave motion is independent of the wave of muscular contraction that drives the locomotion.
Snail climbing grass SMC 07
Cornu aspersum leaving mucus-conserving trail, as seen from above.
Snails crossing a razor.[33]

The snail secretes thixotropic adhesive mucus that permits locomotion by rhythmic waves of contraction passing forward within its muscular "foot". Starting from the rear, the contraction of the longitudinal muscle fibres above a small area of the film of mucus causes shear that liquefies the mucus, permitting the tip of the tail to move forward. The contracted muscle relaxes while its immediately anteriad transverse band of longitudinal fibres contract in their turn, repeating the process, which continues forward until it reaches the head. At that point the whole animal has moved forward by the length of the contraction of one of the bands of contraction. However, depending on the length of the animal, several bands of contraction can be in progress simultaneously, so that the resultant speed amounts to the speed imparted by a single wave, multiplied by the number of individual waves passing along simultaneously.[34]

A separate type of wave motion that may be visible from the side enables the snail to conserve mucus when moving over a dry surface. It lifts its belly skin clear of the ground in arches, contacting only one to two thirds of the area it passes over. With suitable lighting the lifting may be seen from the side as illustrated, and the percentage of saving of mucus may be estimated from the area of wet mucus trail dabs that it leaves behind. This type of wave passes backwards at the speed of the snail's forward motion, therefore having a zero velocity with respect to the ground.

The snail moves at a top speed of 1.3 centimetres per second[35] (47 meters per hour or ~50 yards per hour),[36] and has a strong homing instinct, readily returning to a regular hibernation site.[37]

In spite of its apparent slowness and limitations, the snail exploits the special nature of its mucus to achieve some startling feats. It can go up a slope at any angle, including upside down, resist being pulled off a firm surface with an adhesive strength several times its own weight, rest on a surface at any angle without any expenditure of energy, or, notoriously, climb a needle-like stem or pass over the edge of razor blade without harm, relying on the firmness of its mucus film in its shear-resistant phase.[33]


Human relevance[edit]

Spanish dish, Caracoles-Cascorro, ready to serve.

The species is known as an agricultural and garden pest, an edible delicacy, and occasionally a household pet. In French cuisine, it is known as petit gris, and is served for instance in Escargot a la Bordelaise. Also in Lleida, a city of Catalonia, there is a gastronomic festival called L’Aplec del Caragol dedicated to this type of snail, known as bover, and attracts over 200,000 guests every year. The practice of rearing snails for food is known as heliciculture. For purposes of cultivation, the snails are kept in a dark place in a wired cage with dry straw or dry wood. Coppiced wine-grape vines are often used for this purpose. During the rainy period the snails come out of hibernation and release most of their mucus onto the dry wood/straw. The snails are then prepared for cooking. Their texture when cooked is slightly chewy.

There are a variety of snail-control measures that gardeners and farmers use in an attempt to reduce damage to valuable plants. Traditional pesticides are still used, as are many less toxic control options such as concentrated garlic or wormwood solutions. Copper metal is also a snail repellent, and thus a copper band around the trunk of a tree will prevent snails from climbing up and reaching the foliage and fruit. Caffeine has proven surprisingly toxic to snails, to the extent that spent coffee grounds (genuine coffee, and not decaffeinated) make a safe and immediately effective snail-repellant and even molluscicidal mulch for pot-plants, or for wherever else the supply is adequate.

The decollate snail (Rumina decollata) will capture and eat garden snails, and because of this it has sometimes been introduced as a biological pest control agent. However, this is not without problems, as the decollate snail is just as likely to attack and devour other species of gastropods that may represent a valuable part of the native fauna of the region.

Recently, Cornu aspersum has gained some popularity as the chief ingredient in skin creams and gels (crema/gel de caracol) sold within the Latino community in the USA. These creams are promoted as being suitable for use on wrinkles, scars, dry skin, and acne.

A screen of the secretions that the Cornu aspersum snail produces under stress, to find if it possesses pharmacological properties, has yielded skin-regenerative properties. Some of the cellular and molecular effects underlying this observation are: the secretions contain antioxidant Superoxide dismutase and Glutathione S-transferase (GSTs) activities. In addition, the secretions stimulate fibroblast proliferation and rearrangement of the actin cytoskeleton. Additional mechanisms involved in the regenerative effect of the snail secretions include the stimulation of extracellular matrix assembly and the regulation of metalloproteinase activities. Together, these effects provide an array of molecular mechanisms underlying the secretions’ induced cellular regeneration and postulate its use in regeneration of wounded tissue.[38]

References[edit]

This article incorporates CC-BY-2.0 text from reference.[24]

  1. ^ IUCN (2008). 2008 IUCN Red List of Threatened Species. <www.iucnredlist.org>. Downloaded on 23 February 2009.
  2. ^ Müller O. F. (1774). Vermivm terrestrium et fluviatilium, seu animalium infusoriorum, helminthicorum, et testaceorum, non marinorum, succincta historia. Volumen alterum. pp. I-XXVI [= 1-36], 1-214, [1-10]. Havniae & Lipsiae. (Heineck & Faber).
  3. ^ Ansart A., Vernon P., Daguzan J. 2002. Elements of cold hardiness in a littoral population of the land snail Cornu aspersum (Gastropoda: Pulmonata). Journal of Comparative Physiology B, 172, 619-625.
  4. ^ Machin J. 1966. The evaporation of water from Cornu aspersum IV. Loss from the mantle of the inactive snail. Journal of Experimental Biology, 45, 269-278.
  5. ^ The species was called Cryptomphalus aspersus on p. 244 in the important and widely distributed work Falkner, G. 1990. Binnenmollusken. - pp. 112-280, in: Fechter, R, & Falkner, G.: Weichtiere. Europäische Meeres- und Binnenmollusken. Steinbachs Naturführer 10. -- pp. 1-288. München. (Mosaik).
  6. ^ "The Cornu problem". The Living World of Mollusks. Retrieved 2007-03-05. 
  7. ^ AnimalBase: Genus taxon summary for Cornu (accessed 09 Feb 2011)
  8. ^ Falkner, G., Bank, R. A. & Proschwitz, T. von 2001. Check-list of the non-marine molluscan species-group taxa of the states of northern, Atlantic and central Europe. - Heldia 4 (1/2): 1-76. München.
  9. ^ Falkner, G., Ripken, T. E. J. & Falkner, M. 2002. Mollusques continentaux de France. Liste de référence annotée et bibliographie. - pp. [1-2], 1-350, [1-3]. Paris.
  10. ^ Bank, R., Falkner G. & Proschwitz, T. von 2007. CLECOM-Project. A revised checklist of the non-marine Mollusca of Britain and Ireland. - Heldia 5 (3): 41-72. München.
  11. ^ Manganelli, G., Bodon, M., Favilli, L. & Giusti, F. 1995. Fascicolo 16. Gastropoda Pulmonata. - pp. 1-60, in: Minelli A., Ruffo, S. & La Posta, S.: Checklist delle specie della fauna italiana. Bologna. (Calderini).
  12. ^ Giusti, F., Manganelli, G. & Schembri, P. J. 1995. The non-marine molluscs of the Maltese Islands. - pp. 1-608. Torino.
  13. ^ Neubert, E. 1998. Annotated checklist of the terrestrial and freshwater molluscs of the Arabian Peninsula with descriptions of new species. - Fauna of Arabia 17: 333-461.
  14. ^ Manganelli, G., Salomone, N. & Giusti, F. 2005. A molecular approach to the phylogenetic relationships of the western palaearctic Helicoidea (Gastropoda: Stylommatophora). - Biological Journal of the Linnean Society 85: 501-512.
  15. ^ Sverlova, N. V. 2006. O rasprostranenii nekotorykh vidov nazemnykh mollyuskov na territorii Ukrainy. - Ruthenica 16 (1/2): 119-139. Moskva.
  16. ^ Schileyko, A. A. 2006. Treatise on recent terrestrial pulmonate molluscs, Part 13. Helicidae, Pleurodontidae, Polygyridae, Ammonitellidae, Oreohelicidae, Thysanophoridae. - Ruthenica Supplement 2 (10): 1765-1906.
  17. ^ Egorov, R. 2008. Treasure of Russian shells. Supplement 5. Illustrated catalogue of the recent terrestrial molluscs of Russia and adjacent regions. - pp. 1-179, [1]. Moscow.
  18. ^ Sysoev, A. & Schileyko, A. 2009. Land snails and slugs of Russia and adjacent countries. - pp. 1-312, Fig. 1-142. Sofia. (Pensoft).
  19. ^ Cowie, R. H. (1984). The life-cycle and productivity of the land snail Theba pisana (Mollusca: Helicidae), The Journal of Animal Ecology 53, 311-325
  20. ^ Bezemer T. M. & Knight K. J. 2001. Unpredictable responses of garden snail Helix aspersa populations to climate change. Acta Oecologica, 22, 201-208.
  21. ^ Heller J.: Life History Strategies. in Barker G. M. (ed.): The biology of terrestrial molluscs. CABI Publishing, Oxon, UK, 2001, ISBN 0-85199-318-4. 1-146, cited page: 428.
  22. ^ a b Arkive: Helix aspersa
  23. ^ Commonwealth of Australia. 2002 (April) Citrus Imports from the Arab Republic of Egypt. A Review Under Existing Import Conditions for Citrus from Israel. Agriculture, Fisheries and Forestry, Australia. Caption: Gastropods, page 12 and Appendix 2.
  24. ^ a b c Annie Guiller A. & Madec L. (2010) "Historical biogeography of the land snail Cornu aspersum: a new scenario inferred from haplotype distribution in the Western Mediterranean basin:. BMC Evolutionary Biology 10: 18. doi:10.1186/1471-2148-10-18
  25. ^ Pfleger, V. & Chatfield, J. (1983). A guide to snails of Britain and Europe. Hamlyn, London.
  26. ^ Juřičková L. & Kapounek F. (18 November 2009) "Helix (Cornu) aspersa (O.F. Müller, 1774) (Gastropoda: Helicidae) in the Czech Republic". Malacologica Bohemoslovaca 8: 53-55. PDF.
  27. ^ UF/IFAS Featured Creatures: Helix aspersa
  28. ^ USDA grazing systems and alternative livestock breeds [1]
  29. ^ Fisher TW, Orth RE, Swanson SC. 1980. "Snail against snail." California Agriculture, 34(11): 18-20. Abstract.
  30. ^ Beeby, A., Richmond, L. (1989). The shell as a site of lead deposition in Cornu aspersum, Archives of Environmental Contamination and Toxicology 18, 623-628
  31. ^ (French) Morand S. & Petter A. J. (1986). "Nemhelix bakeri n.gen., n.sp. (Nematoda: Cosmocercinae) parasite de l'appareil génital de Helix aspersa (Gastropoda: Helicidae) en France". Canadian Journal of Zoology 64(9): 2008-2011. doi:10.1139/z86-303.
  32. ^ (French) Morand S. (1988). "Cycle évolutif du Nemhelix bakeri Morand et Petter (Nematoda, Cosmocercidae), parasite de l'appareil génital de l'Helix aspersa Müller (Gastropoda, Helicidae)". Canadian Journal of Zoology 66(8): 1796-1802. doi:10.1139/z88-260.
  33. ^ a b Bonnier Corporation (July 1919). Popular Science. Bonnier Corporation. pp. 42–. ISSN 0161-7370. 
  34. ^ Chan, Brian. Balmforth, N. J. Hosoi A. E. Building a better snail: Lubrication and adhesive locomotion. Phys. Fluids 17, 113101 (2005); http://dx.doi.org/10.1063/1.2102927
  35. ^ Speed of a Snail
  36. ^ Velocity Measurement Units Conversion
  37. ^ Attia J. 2004. Behavioural Rhythms of Land Snails in the Field. Biological Rhythm Research, 35: 35-41. Abstract.
  38. ^ [2] Skin Pharmacology and Physiology. Vol. 21 ISSN: 1660-5527. Molecular basis for the regenerative properties of a secretion of the mollusk Cryptomphalus aspersa. January 2008.

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!