Overview

Distribution

77.5°N to 41.7°N; 70.7°W to 20°W, Greenland to Massachusetts
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal, bathyal, infralittoral and circalittoral of the Gulf and estuary
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 613 specimens in 2 taxa.
Water temperature and chemistry ranges based on 483 samples.

Environmental ranges
  Depth range (m): 9 - 673
  Temperature range (°C): -0.641 - 17.422
  Nitrate (umol/L): 1.560 - 37.435
  Salinity (PPS): 27.473 - 35.253
  Oxygen (ml/l): 0.976 - 7.862
  Phosphate (umol/l): 0.106 - 3.059
  Silicate (umol/l): 1.599 - 117.368

Graphical representation

Depth range (m): 9 - 673

Temperature range (°C): -0.641 - 17.422

Nitrate (umol/L): 1.560 - 37.435

Salinity (PPS): 27.473 - 35.253

Oxygen (ml/l): 0.976 - 7.862

Phosphate (umol/l): 0.106 - 3.059

Silicate (umol/l): 1.599 - 117.368
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chlamys islandica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTGTTGCCTTTGTTACTGGGGGGCCTCGATATAAGGTTTCAGCGGGTGAATGCCCTTAGATTCTGGCTTGTTCCTTTCGCCCTTTATATGGTGGTGGTGTCCCCTTTTATGGAGCAGGGGAGCGGAACAGGATGAACCATATATCCTCCTTTGTCTTCTACTCCATACCAGGGGGATATTTGCACAGACATAGTAATCTTAGGGTTGCATTTGTCTGGGGTAAGCTCTACTGCTGGGGCGATTAATTATCTGGTTACTTTTTTAAACATACGCGGAAAGTCCTATAAGGCGGAGTTTTGTCCGCCCTTCGTTTGGGCTTTAGCCGTAACGAGTTTTTTGCTAATAATATCTCTTCCTGTTCTAGCTGGGGGGCTGACAATATTAATTATAGATCGTCACTTTAACTGTACATTTTTTGACCCTTCTGGGGGGGGGGATCCTGTGTTGTTCCAGCACCTTTTTTGGTTTTTTGGACATCCTGAGGTCTACGTGCTTATTCTTCCTGGGTTTGGTTTAGTGTCACATATTCTAGTTTTCTACACTAAGAAAATTCGGGTGTTTGGGGCAGTGGCCATAATGTATGCTATGATTTCAATTGGAATTTTAGGGTTTATTGTTTGGGGCCATCATATGTTTACTGTTGGGTTGGATGCGGATACTCGGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chlamys islandica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Chlamys islandica

The Iceland scallop (Chlamys islandica) is a species of bivalve mollusc in the family Pectinidae. It can be found along the Atlantic coast of North America, ranging from Greenland to Massachusetts.[1]

References[edit]

  1. ^ Abbott, R.T. & Morris, P.A. A Field Guide to Shells: Altantic and Gulf Coasts and the West Indies. New York: Houghton Mifflin, 1995. 27.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!