Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Seen on a world scale, the great scallop is the most important shellfish for the fisheries. More than a million tons are fished yearly. The shell is the logo for Shell, but also for the pilgrims that used to travel to the town of Santiago de Compostella in Galicia (northwest Spain). Pilgrims took the scallop with them, in honor of Saint James. This is also another name for the great scallop. The animals are very lively. They can jump and even swim around by quickly opening and closing their valves. They have light-sensitive spots on the edges of the mantle which help them to 'see'.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Both shell valves are fan shaped with an 'ear' on either side of the apex of the valve. The right valve is strongly convex and tends to be off-white, yellowish, or light brown in colour, often with bands or spots of darker pigment. The left valve is flat and is light pink to reddish brown in colour. Pecten maximus grows up to 15 cm long and both valves each have 15-17 radiating ribs.Also known as the King scallop, Giant scallop, escallop and Coquille St. Jacques.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Atlantic Europe, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Isles, De Haan, De Panne, East Coast of England, English Channel, European waters (ERMS scope), Irish Exclusive economic Zone, Morocco, Norwegian Exclusive Economic Zone, Oostende, Spanish Exclusive Economic Zone [Atlantic part], Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Living specimens of Pecten maximus are often supplied by the fisherman. The exact origin is not known (Vanwalleghem, in litt.).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Beninger et al. (1994) showed that the inner demibranchs of the gills develop earlier than the outer demibranchs. Plication of the gill filaments is also attained relatively late in ontogeny. The gills of early juveniles of the species are thus structurally and functionally different from those of the adult stage.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Sartori, André F.

Source: Molluscs - eBivalvia LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 280 specimens in 2 taxa.
Water temperature and chemistry ranges based on 57 samples.

Environmental ranges
  Depth range (m): -9 - 100
  Temperature range (°C): 7.867 - 15.917
  Nitrate (umol/L): 2.271 - 9.954
  Salinity (PPS): 34.243 - 37.404
  Oxygen (ml/l): 4.619 - 6.384
  Phosphate (umol/l): 0.099 - 0.831
  Silicate (umol/l): 1.872 - 7.971

Graphical representation

Depth range (m): -9 - 100

Temperature range (°C): 7.867 - 15.917

Nitrate (umol/L): 2.271 - 9.954

Salinity (PPS): 34.243 - 37.404

Oxygen (ml/l): 4.619 - 6.384

Phosphate (umol/l): 0.099 - 0.831

Silicate (umol/l): 1.872 - 7.971
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Usually found in a shallow depression in the seabed. Prefers areas of clean firm sand, fine or sandy gravel and may occasionally be found on muddy sand. Distribution in this species is invariably patchy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pecten maximus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTCGTTGGTTTATGGCTAATTCTCATAAGGATGTTGGAACTATATATCTAATGTTGGGGATGTGGTCGGGTTTTGGGGGTTTAAATCTTAGTTGGATAATGCGTTTAGAGCTAAGGCGGCCAGGAATGTGGTTACCTAGG---TCTGAAGTATACAATGGTATTGTTACTTTACATGCTATTATGATGATTTTTTCCTTTGTTATGCCAGTGCTTATTGGTGGTTTTGGGAATTGGTTGTTGCCTATAATACTAGGTTCAATTGATATGAGTTTTCCTCGGCTTAATACGTTTAGTTTTTGAGTTCTTCCTCCTGCTCTTTATTTAGTGATTGTTTCTTGTTTTATCGACTATGGCAGAGGAACTGGGTGGACTATGTATCCGCCTTTGTCTAGGACTCCTTATTCTGGTGGAATCAGAACTGATTTGATGATTTTGGGGCTTCATTTGGCGGGGATTAGTTCTTCGGCTGAATCTATTAACTATTTAGTCACTTTCTTAAATGTGCGAAGTAAGTCTTTTAAGGCTGAATTTTCCCCTCTTTTCGTGTGGGCTCTGGCTGTCACTAGTTTTTTATTATTGGTGTCTTTGCCTGTATTGGCTGGTGGGTTAACTATACTGATTATAGATCGGGATTTTAACTGTAGGTTCTTTGACCCTTCGGGAGGAGGAGATCCTGTTTTATTCCAACACCTTTTTTGGTTTTTTGGGCATCCTGAAGTTTATGTTCTAATTTTACCAGGGTTTGGTTTAGTGTCTCATGTTTTAGTATTTTATACTAAGAAGTTACGAGTTTTTGGTTCTGTGGCTATAATATATGCTATAATTTCTATTGGTGTTCTTGGTTTCATTGTTTGGGGTCATCACATGTATACTGTTGGTTTGGATGTAGATACCCGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pecten maximus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pecten maximus

Pecten maximus, common name the "great scallop" or "king scallop", is a species of scallop, an edible saltwater clam, a marine bivalve mollusc in the family Pectinidae, the scallops.

This is the type species of the genus.

This species may in fact be conspecific with Pecten jacobaeus, the "pilgrim's scallop", which has a much more restricted distribution. [1]

The energy corporation Royal Dutch Shell derives its highly recognizable logo from this species.

Live individual of Pecten maximus on the right, next to Ostrea edulis

References

  • MarLIN info at: [2]
  • ITIS info at: [3]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!