Table of Contents
Articles on this page are available in 1 other language: Dutch (1) (learn more)
Overview
Brief Summary
Seen on a world scale, the great scallop is the most important shellfish for the fisheries. More than a million tons are fished yearly. The shell is the logo for Shell, but also for the pilgrims that used to travel to the town of Santiago de Compostella in Galicia (northwest Spain). Pilgrims took the scallop with them, in honor of Saint James. This is also another name for the great scallop. The animals are very lively. They can jump and even swim around by quickly opening and closing their valves. They have light-sensitive spots on the edges of the mantle which help them to 'see'.
© Copyright Ecomare
Source:
Ecomare
Trusted
Comprehensive Description
Description
Both shell valves are fan shaped with an 'ear' on either side of the apex of the valve. The right valve is strongly convex and tends to be off-white, yellowish, or light brown in colour, often with bands or spots of darker pigment. The left valve is flat and is light pink to reddish brown in colour. Pecten maximus grows up to 15 cm long and both valves each have 15-17 radiating ribs.Also known as the King scallop, Giant scallop, escallop and Coquille St. Jacques.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Distribution
Atlantic Europe, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Isles, De Haan, De Panne, East Coast of England, English Channel, European waters (ERMS scope), Irish Exclusive economic Zone, Morocco, Norwegian Exclusive Economic Zone, Oostende, Spanish Exclusive Economic Zone [Atlantic part], Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
-
Müller, Y. (2004). Faune et flore du littoral du Nord, du Pas-de-Calais et de la Belgique: inventaire. [Coastal fauna and flora of the Nord, Pas-de-Calais and Belgium: inventory]. Commission Régionale de Biologie Région Nord Pas-de-Calais: France. 307 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9269
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
-
Vanhaelen, M.-Th. (2005). Nog enkele zeldzame bivalve-vondsten op de Belgische Westkust in de winter van 2004-2005 [More rare finds of bivalves at the Belgian west coast in the winter of 2004-2005]. De Strandvlo 25(2): 55-57
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=9185
-
Vanhaelen, M.-Th. (2002). Enkele interessante vondsten van mollusken aan de Westkust tijdens de winter 2001-2002 [Some interesting findings of mollusks at the west coast in winter 2001-2002]. De Strandvlo 22(3-4): 117-118
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1092
-
Hayward, P.J.; Nelson-Smith, A.; Shields, C. (1999). Gids van Kust en strand. Tirion. 352 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6829
-
d'Udekem d'Acoz, C. (1990). Notes on some organisms collected between Wenduine and De Haan on 3 March 1990 [Notes sur quelques organismes recueillis entre Wenduine et De Haan le 3 mars 1990]. De Strandvlo 10(3): 74-78
http://www.marinespecies.org/ophiuroidea/aphia.php?p=sourcedetails&id=138631
-
Vanderperren, J.-P. (1991). Report Natural History Archive 1990 [Verslag Natuurhistorisch Archief 1990]. De Strandvlo 11(3): 65-75
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=139287
-
Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=1364
-
Ardovini, R.; Cossignani, T. (2004). West African seashells (including Azores, Madeira and Canary Is.) = Conchiglie dell'Africa Occidentale (incluse Azzorre, Madeira e Canarie). English-Italian edition. L'Informatore Piceno: Ancona, Italy. ISBN 88-86070-11-X. 319 pp.
http://www.marinespecies.org/mollusca/aphia.php?p=sourcedetails&id=7029
-
Vanhaelen, M.-Th. (2003). Stranding van levende Aequipecten opercularis (L., 1758) en vondsten van levende Pecten maximus (L., 1758) na zware oktoberstorm 2002 [Strandings of living Aequipecten opercularis (L., 1758) and findings of living Pecten maximus (L., 1758) after severe October storm 2002]. De Strandvlo 23(2): 42-46
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1668
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Guiry, M.D. & Guiry, G.M. (2011). Species.ie version 1.0 World-wide electronic publication, National University of Ireland, Galway (version of 15 March 2010).
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149068
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Living specimens of Pecten maximus are often supplied by the fisherman. The exact origin is not known (Vanwalleghem, in litt.).
-
Backeljau, T. (1986). Lijst van de recente mariene mollusken van België [List of the recent marine molluscs of Belgium]. Koninklijk Belgisch Instituut voor Natuurwetenschappen: Brussels, Belgium. 106 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Physical Description
Morphology
Beninger et al. (1994) showed that the inner demibranchs of the gills develop earlier than the outer demibranchs. Plication of the gill filaments is also attained relatively late in ontogeny. The gills of early juveniles of the species are thus structurally and functionally different from those of the adult stage.
© Sartori, André F.
Source:
Molluscs - eBivalvia LifeDesk
Trusted
Ecology
Habitat
Depth range based on 280 specimens in 2 taxa.
Water temperature and chemistry ranges based on 57 samples.
Environmental ranges
Depth range (m): -9 - 100
Temperature range (°C): 7.867 - 15.917
Nitrate (umol/L): 2.271 - 9.954
Salinity (PPS): 34.243 - 37.404
Oxygen (ml/l): 4.619 - 6.384
Phosphate (umol/l): 0.099 - 0.831
Silicate (umol/l): 1.872 - 7.971
Graphical representation
Depth range (m): -9 - 100
Temperature range (°C): 7.867 - 15.917
Nitrate (umol/L): 2.271 - 9.954
Salinity (PPS): 34.243 - 37.404
Oxygen (ml/l): 4.619 - 6.384
Phosphate (umol/l): 0.099 - 0.831
Silicate (umol/l): 1.872 - 7.971
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 57 samples.
Environmental ranges
Depth range (m): -9 - 100
Temperature range (°C): 7.867 - 15.917
Nitrate (umol/L): 2.271 - 9.954
Salinity (PPS): 34.243 - 37.404
Oxygen (ml/l): 4.619 - 6.384
Phosphate (umol/l): 0.099 - 0.831
Silicate (umol/l): 1.872 - 7.971
Graphical representation
Depth range (m): -9 - 100
Temperature range (°C): 7.867 - 15.917
Nitrate (umol/L): 2.271 - 9.954
Salinity (PPS): 34.243 - 37.404
Oxygen (ml/l): 4.619 - 6.384
Phosphate (umol/l): 0.099 - 0.831
Silicate (umol/l): 1.872 - 7.971
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Usually found in a shallow depression in the seabed. Prefers areas of clean firm sand, fine or sandy gravel and may occasionally be found on muddy sand. Distribution in this species is invariably patchy.
© The Marine Biological Association of the United Kingdom
Source:
Marine Life Information Network
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Pecten maximus
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TCTCGTTGGTTTATGGCTAATTCTCATAAGGATGTTGGAACTATATATCTAATGTTGGGGATGTGGTCGGGTTTTGGGGGTTTAAATCTTAGTTGGATAATGCGTTTAGAGCTAAGGCGGCCAGGAATGTGGTTACCTAGG---TCTGAAGTATACAATGGTATTGTTACTTTACATGCTATTATGATGATTTTTTCCTTTGTTATGCCAGTGCTTATTGGTGGTTTTGGGAATTGGTTGTTGCCTATAATACTAGGTTCAATTGATATGAGTTTTCCTCGGCTTAATACGTTTAGTTTTTGAGTTCTTCCTCCTGCTCTTTATTTAGTGATTGTTTCTTGTTTTATCGACTATGGCAGAGGAACTGGGTGGACTATGTATCCGCCTTTGTCTAGGACTCCTTATTCTGGTGGAATCAGAACTGATTTGATGATTTTGGGGCTTCATTTGGCGGGGATTAGTTCTTCGGCTGAATCTATTAACTATTTAGTCACTTTCTTAAATGTGCGAAGTAAGTCTTTTAAGGCTGAATTTTCCCCTCTTTTCGTGTGGGCTCTGGCTGTCACTAGTTTTTTATTATTGGTGTCTTTGCCTGTATTGGCTGGTGGGTTAACTATACTGATTATAGATCGGGATTTTAACTGTAGGTTCTTTGACCCTTCGGGAGGAGGAGATCCTGTTTTATTCCAACACCTTTTTTGGTTTTTTGGGCATCCTGAAGTTTATGTTCTAATTTTACCAGGGTTTGGTTTAGTGTCTCATGTTTTAGTATTTTATACTAAGAAGTTACGAGTTTTTGGTTCTGTGGCTATAATATATGCTATAATTTCTATTGGTGTTCTTGGTTTCATTGTTTGGGGTCATCACATGTATACTGTTGGTTTGGATGTAGATACCCGTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Pecten maximus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Wikipedia
Pecten maximus
Pecten maximus, common name the "great scallop" or "king scallop", is a species of scallop, an edible saltwater clam, a marine bivalve mollusc in the family Pectinidae, the scallops.
This is the type species of the genus.
This species may in fact be conspecific with Pecten jacobaeus, the "pilgrim's scallop", which has a much more restricted distribution. [1]
The energy corporation Royal Dutch Shell derives its highly recognizable logo from this species.
.jpg)
References
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
