Overview

Distribution

The elktoe is found in the upper Mississippi drainage in the Ohio, Cumberland and Tennessee River systems as well as the Susquehanna River. In the Great Lakes region it is in the St. Lawrence drainage from Lake Huron to the Ottawa River. In general its range spans from western New York and Pennsylvania, west to Wisconsin, and south to northern Alabama.

In Michigan this species is found in rivers in both the upper and lower peninsulas, but may be absent from the coldwater rivers and streams in the northwest part of the state.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species ranges in the north from Ontario, Canada (Great Lakes and St. Lawrence drainage) south to Alabama (Tennessee drainage) and on the east from New York (Susquehanna and St. Lawrence drainages) to Virginia (Ohio drainage) and on the west from eastern North Dakota to northeastern Oklahoma (historic records only), with the center of abundance being in Ohio, Indiana and Illinois (Parmalee and Bogan, 1998; Burch, 1989; Clarke, 1981). Starret (1971) reported that it historically occurred in the upper and middle parts of the Illinois River in Illinois but was eliminated by pollution following the opening of the Chicago Sanitary Canal in 1900. Ortman (1919) also indicated that this species had been extirpated from the Monongahela drainage in Pennsylvania. Today the entire main Cheat River is devoid of unionid bivalves due to acid mine drainage. The Atlantic slope form (var. susquehannae) is found in the Susquehanna basin of Pennsylvania and New York as well as the upper St. Lawrence River, Canada (Ortman, 1919; Johnson, 1970). It has not been reported in Alabama for several decades so likely extirpated there (Mirarchi et al., 2004). Parmalee and Bogan (1998) cite it as formerly occurring in the Watauga, Elk, and Buffalo Rivers and preimpoundment main channels of the Tennessee and Cumberland Rivers in Tennessee, but no longer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The elktoe is up to 10 cm (4 inches) long , and is elongate and quadrate. The shell is usually fairly thin and inflated. The   anterior end is rounded, the posterior end is bluntly ended in a squarish point. The dorsal margin is slightly rounded and the ventral margin is nearly straight.

Umbos are broad and elevated above the hinge line. The beak sculpture is three to five heavy, raised, double-looped ridges.

The periostracum (outer shell layer) is smooth, yellow-brown with broad green rays and dark green dots. The posterior end of the shell is usually lighter.

On the inner shell, both   left and right valves have a thin, elongated, pseudocardinal tooth. Lateral teeth are absent but there is a swelling on the hinge line.

The beak cavity is moderately deep. Although the nacre is white, occasionally it is has a salmon tint near the beak.

In Michigan, this species can be confused with the snuffbox, slippershell, and deertoe. The snuffbox is generally smaller, more square, and females have teeth ridges at the posterior margin. Slippershells are smaller, therefore growth lines are closer together. The deertoe has a more rounded ventral margin. The elktoe is spotted with dark green dots, which are absent in the other species. The foot of a live elktoe also tends to have an orangish color.

Range length: 10 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Ortman (1919) describes a subspecies (A. MARGINATA SUSQUEHANNAE Ortman 1913) from the Susquehanna River basin in Pennsylvania. This Atlantic slope form has identical soft parts and glochidia but the truncation of the posterior end is not as pronounced. The shell is somewhat smaller and the epidermis is brighter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

The elktoe is usually found in larger creeks the upper reaches of rivers. Substrates where it was found are described as mixed sand and gravel.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Although it occurs in large to medium sized streams, it is more typical of smaller streams (Buchanan, 1980; Goodrich and Van Der Schalie, 1944; Oesch, 1984; Parmalee, 1967; Wilson and Clark, 1914). Ortman (1919) described it as a riffle species that is found in swift current in firmly packed fine to course gravel. Parmalee (1967) reported the preferred habitat to be small streams with good current and sand or gravel bottoms at depths of several inches to two feet. Buchanan (1980) found it to be common in gravel and cobble substrate in two to 18 inches of water, Neel and Allen (1964) found it to be more abundant in the mainstream Cumberland River than in small streams. Parmalee and Bogan (1998) state that it reaches its greatest abundance in small, shallow rivers with a moderately fast current in a mixture of fine gravel and sand.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Besides reproduction, gills are also used for both respiration and feeding. It is believed that food consists of suspended organic material such as detritus, bacteria and algae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

While freshwater mussels require a host fish for metamorphosis, the host for the elktoe is unknown.

Ecosystem Impact: parasite

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: Ohio alone has over 100 occurrences; primarily in free-flowing large creeks in most Ohio and Lake Erie tribs. (rare in unglaciated Ohio) (Watters, 1995; Lyons et al., 2007; Watters et al., 2009). Four states (Illinois, Pennsylvania, Tennessee, Wisconsin) have a substantial number of populations and it is known to occur in at least 14 states. In Illinois, it is generally distributed though uncommon in the northern half (Cummings and Mayer, 1997; Schanzle and Cummings, 1991; Tiemann et al., 2005); also upper Illinois (Sietman et al., 2001). It was recently documented in the Fox River basin in Illinois and Wisconsin (Schanzle et al., 2004). In Indiana it occurs in the St. Joseph and Maumee (Pryor, 2005), lower East Fork White (Harmon, 1992) and Tippecanoe (Cummings and Berlocher, 1990). Kentucky has 70 occurrences listed with only 23 extant (in 15 counties) sporadically throughout the eastern half of the state (Cicerello and Schuster, 2003; Clark, 1988). In Tennessee, it occurs in small and medium streams of the Tennessee and Cumberland River drainages, east/middle Tennessee including unimpounded stretches of the Clinch and Powell Rivers, Nolichucky, Hiwassee, and Duck and Red Rivers as well as small tributary streams of these rivers (Parmalee and Bogan, 1998). Reported by Johnson et al. (2005) from the Hiwassee River inside/ear Cherokee National Forest, Polk Co., Tennessee. In Alabama it is only known since 1909 from one midden shell from Paint Rock River in 2004 (Williams et al., 2008). In Minnesota, it is rare to uncommon in the Mississippi River below St. Anthony Falls and some southeastern streams including the St. Croix River drainage (Sietman, 2003). In Wisconsin, it is widespread though spotty but with several populations with high numbers (Mathiak, 1979). In South Dakota, this species is very rare with a few shells reported from the Big Sioux River (Backlund, 2000; Skadsen and Perkins, 2000). Although Vidrine (1993) did not report the species in Louisiana, it does occur just over the border in southern Arkansas. It occurs in the lower Arkansas (Frog Bayou) in Arkansas (Gordon, 1985). In Missouri, it can be found in most rivers draining the Springfield and Salem plateaus and can also be found in two of the tributaries of the Mississippi River- the Salt River and Cuivre River (Oesch, 1995). It is rare in Oklahoma in the Illinois and Neosho Rivers (Branson, 1983). In Kansas, it is known from the Spring River (Branson, 1966- to OK) where it is rare and the Marais des Cygnes River (Couch, 1997). New sites were discovered in the Greenbrier River drainage in West Virginia (anonymous, 1996) and it is in the New River, West Virginia (Jirka and Neves, 1990). In Virginia, it occurred widely in the New River tributaries draining the Ride and Valley and Blue Ridge, but recently is very rare (1 site) in the Upper New River drainage (Pinder et al., 2002), rare Reed Creek, Sinking Creek (Giles Co.), and Wolf Creek (Bland Co.) (Pinder et al., 2002), upper South Fork Holston (Stansbery and Clench, 1978). It is historical in the Upper Clinch in Virginia (Jones et al., 2001). Specimens from the Black River (St. Clair drainage- see Strayer, 1980), Michigan, were relocated to the Detroit River in 1992 (Trdan and Hoeh, 1993); also in southern upper peninsula (Goodrich and Van der Schalie, 1939), Kalamazoo River (Mulcrone and Mehlne, 2001), Lake Michigan, St. Clair-Detroit (Badra and Goforth, 2003). Though not common it Pennsylvania, it is known from the Susquehanna and Ohio drainages and Little Mahoning Creek (Chapman and Smith, 2008). In 2007 it was reported from the Lamoille River, Vermont, between Fairfax Falls and Fairfax to Georgia, the first state record (Kart et al., 2005). In Canada, it is broadly distributed throughout the Lake Huron, Lake St. Clair, Lake Erie, and Lake Ontario drainages and is frequently encountered and often plentiful (Metcalfe-Smith and Cadmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Although wide ranging, this species usually occurs in very small numbers, with survey efforts often yielding only one individual at a site; some states have significant populations. Smith and Crabtree (2010) found this species at 9 of 32 sites (7 with recruitment) along the entire length of Pennsylvania's French Creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. Mantle flaps in the lampsilines are modified to attract potential fish hosts. How the elktoe attracts and if it recognizes its fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Alasmidonta marginata is a long-term brooder. In the Huron River, it was gravid from early August to late May. It likely spawns from June to July.

Breeding interval: The elktoe breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably June to July.

Range gestation period: 10 (high) months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As with most unionid bivalves, this mussel requires a fish host. Howard and Anson (1922) list white sucker (Catastomus commersoni), northern hog sucker (Hypentelium nigricans), shorthead redhorse (Moxostoma nacrolepidotum), rockbass (Ambloplites rupestris), and warmouth (Lepomis gulosus) as fish hosts. Breeding season is bradytictic (Utterback, 1915) meaning the mussel is long term breeder, retaining developing glochidial larvae in gills throughout the year. It only uses the outer gills as marsupia and does not form conglutinates though embryos are held in mucous masses (Oesch, 1984).

Though these mussels are capable of limited movement, dispersal into new areas is primarily accomplished by the fish host movement.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alasmidonta marginata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTGTTGTTTGCTTTGTGGTCGGGTTTAATTGGGTTGGCTTTAAGTCTTTTAATTCGAGCTGAGTTAGGTCAACCGGGAAGGCTATTGGGTGAT---GATCAGTTGTATAATGTCATTGTTACGGCTCATGCTTTTATAATAATTTTTTTTTTGGTAATACCTATAATAATTGGTGGGTTTGGTAATTGACTTATTCCTTTGATGATTGGTGCTCCTGATATGGCTTTTCCTCGGTTAAATAATTTAAGATTTTGACTTCTTGTACCAGCTTTGTTTTTGTTGTTAAGGTCTTCACTGGTGGAGAGTGGTGTAGGTACTGGTTGAACAGTATATCCCCCTTTATCAGGAAATGTTGCTCATTCTGGAGCTTCTGTGGATTTGGCTATTTTTTCTTTGCACCTTGCTGGGGCTTCATCAATTTTAGGTGCTATTAACTTTATTTCTACTGTTGGAAATATGCGATCTCCTGGTTTAATTGCTGAGCGAATTCCTTTATTTGTTTGGGCTGTTACTGTGACGGCCGTGTTATTGGTTGCTGCTTTGCCAGTTTTAGCTGGTGCTATTACAATGTTACTCACTGATCGTAATTTAAATACTTCATTTTTTGATCCTACGGGAGGGGGAGATCCTATTTTATAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alasmidonta marginata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The IUCN has not rated the conservation status of Alasmidonta marginata because not enough is known about its abundance. The elktoe is listed as endangered in Kansas, threatened in Minnesota, and a species of special concern in Virginia and in Michigan.

US Federal List: no special status

CITES: no special status

State of Michigan List: special concern

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
2.3

Year Assessed
2000
  • Needs updating

Assessor/s
Bogan, A.E. (Mollusc Specialist Group)

Reviewer/s
Seddon, M.B. (Mollusc Red List Authority)

Contributor/s

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: This species is widely distributed but is never abundant at any particular site, often occurring as single individuals. It has been extirpated from certain parts of the outer edges of its range and although still fairly common, recently it has experienced some decline (around 10-20% overall) in several areas but primarily is considered secure throughout the main portion of its range.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Sensitive to pollution, siltation, habitat loss, impoundment, and loss of fish hosts.

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Comments: Although it occurs in large to medium sized streams, it is more typical of smaller streams (Buchanan, 1980; Goodrich and Van Der Schalie, 1944; Oesch, 1984; Parmalee, 1967; Wilson and Clark, 1914). Ortman (1919) described it as a riffle species that is found in swift current in firmly packed fine to course gravel. Parmalee (1967) reported the preferred habitat to be small streams with good current and sand or gravel bottoms at depths of several inches to two feet. Buchanan (1980) found it to be common in gravel and cobble substrate in two to 18 inches of water, Neel and Allen (1964) found it to be more abundant in the mainstream Cumberland River than in small streams. Parmalee and Bogan (1998) state that it reaches its greatest abundance in small, shallow rivers with a moderately fast current in a mixture of fine gravel and sand.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: In Canada, this species shows no evidence of decline and may be increasing in abundance in some locations in Ontario (Metcalfe-Smith and Cadmore-Vokey, 2004). Significant declines have occurred in Virginia where this species is on the verge of state extirpation (Pinder et al., 2002). Starret (1971) reported that it historically occurred in the upper and middle parts of the Illinois River in Illinois but was eliminated by pollution following the opening of the Chicago Sanitary Canal in 1900. Ortman (1919) also indicated that this species had been extirpated from the Monongahela drainage in Pennsylvania. Today the entire main Cheat River is devoid of unionid bivalves due to acid mine drainage. It has not been reported in Alabama for several decades so likely extirpated there (Mirarchi et al., 2004) with the last reported specimen from 1909 in Shoal Creek, Lauderdale Co., with the exception fo a single shell from a muskrat midden in 2004 from the Paint Rock River in Jackson Co. (Williams et al., 2008). Parmalee and Bogan (1998) cite it as formerly occurring in the Watauga, Elk, and Buffalo Rivers and preimpoundment main channels of the Tennessee and Cumberland Rivers in Tennessee, but no longer. It is likely extirpated from Swan Creek (Lower Maumee drainage) in Ohio (Grabarciewicz, 2008).

Global Long Term Trend: Relatively stable to decline of 50%

Comments: This species is extremely rare or extirpated from the North Fork Holston River, Virginia (Jones and Neves, 2007). It occurred historically in Alabama in the Tennessee River but was rare with the only recent material being a midden shell on the Paint Rock River, Jackson Co. in 2004, and Shoal Creek, Lauderdale Co. in 1909 (Williams et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: The most common threats to this species noted by the states are agricultural, urban and industrial runoff, impoundments or altered hydrology, coal mining (acid mine drainage, increased sedimentation, etc.), oil and gas development, stream gravel removal, and clear cutting of forest and riparian vegetation. As with most unionid bivalves, historically the most serious threat to riverine species has been impoundment. Impoundment removes the current which is necessary for most species to maintain their basic physiological processes such as feeding. Reduced water flow also results in settling out of suspended solids, such as silt, and decreased oxygen concentrations in bottom water. Because of stratification within the impoundment, water released from the lowest depths of a reservoir will be colder and lower in water quality. Reduced water quality exists due to accumulation of more silt which may contain contaminants, and less oxygen and therefore will most likely be less able to sustain mussel populations downstream. Surface water from the reservoir could be beneficial to mussels below the dam by supplying an organic rich food supply (phytoplankton). Regulation of a more constant water flow through controlled releases may also benefit mussels downstream however the contrary is more common with the dewatering of downstream areas when water is held upstream for a later 'controlled release'. Dams may also serve as barrier to host fish movements. Fuller (1974) listed 'trash fish' removal as a threat to unionids in general due to host fish lost. This practice to enhance sport fishing is no longer common practice though host fish loss is still a threat from habitat loss. Species like A. MARGINATA, whose range extends into Appalachia are impacted by coal-mines from strip-mining, silt, and coal washings (Ahlstedt and Brown 1980). Acidity from acid mine drainage effects the shells of the mussels. Mussels living in streams in agricultural areas may experience runoff from farms containing herbicides, pesticides, fertilizers, and silt. In other areas industrial and residential pollution and sewage may be a problem. Dredging, whether for channel modification or for the recovery of sand and gravel, can also impact mussels by destruction of habitat or the removal of individuals. A serious threat to freshwater mussels is siltation, which is a result of mining and associated practices, road construction, farming and logging (USFWS, 1985; Dennis, 1984). Heavy loads of silt washed into rivers and streams can potentially bury the heavy-shelled riverine species (Ellis, 1936). Silt can also interfere with feeding, effectively diluting the amount of food that the mussels are able to ingest (Dennis, 1984). Natural threats include raccoons and muskrats as predators.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: As with most unionids, many areas of historical element occurrences cannot be restored because of river modification. Other former habitats can probably be recovered if water quality is sufficiently upgraded and mussels are reintroduced provided suitable fish hosts are also present.

Preserve Selection and Design Considerations: Adequate water quality and habitat must be available, preferably a shallow riffle with stable gravel substrate. Fish hosts should be present. As this is a thin shelled species, stream access by livestock and humans should be limited due to the crushing potential. Adequate buffer zones along streams should be developed to help retard agricultural runoff.

Management Requirements: The first need is to determine the actual status. Due to the lack of tracking information, only half (nine) of the states contained in the range have a status ranking for this species. Known populations should have their reproductive potential investigated (fish hosts available, presence of several age classes, viable glochidia, etc.) to see if these occurrences are just single individuals.

Management Research Needs: Existing populations should be sampled to determine their age structure and reproductive potential.

Biological Research Needs: Existing populations should be sampled to determine their age structure and reproductive potential as well as life history and ecological studies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: No known preserves exist for this species. Although it occurs in the Clinch River system of Tennessee and Virginia which has several mussel sanctuaries. It is possible that a few individuals may be located within these areas. Also TNC has property on Big Darby Creek in Ohio which could afford this species some protection. This species occurs in Muddy Creek (French Creek drainage) in the Erie NWR in Crawford Co., Pennsylvania (Mohler et al., 2006).

Needs: Work with local, state and federal agencies on issues relating to development, water quality, preservation and restoration of habitat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: This mussel is listed as federal species of concern (Category II). Most states describe it as wide ranging but not abundant at any site. As such, it will be difficult to arrange site protection. As with all unionid bivalves, maintaining water quality, flow, and ensuring that the host fish species are present is essential. Several common fish species are known as hosts therefore water quality and maintaining adequate habitat would be of primary importance. The best site in Kentucky was recently lost to habitat destruction (R. Cicerello, pers. comm.).

Species Impact: No impacts on other species or the environment are known. The mussel may have potential for filtering pollutants out of the water column and binding them within their tissue or excreting them into pseudo-feces. Either may make pollutants available for bioaccumilation into other species from predation of the mussel or consumption of the feces.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Elktoe

The elktoe, scientific name Alasmidonta marginata, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

Distribution[edit]

This species is found in Canada and the United States.

References[edit]

  1. ^ Bogan, A.E 2000. Alasmidonta marginata. 2006 IUCN Red List of Threatened Species. Downloaded 6 August 2007.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!