Overview

Distribution

Range Description

The range of this species is unclear due to taxonomic uncertainty with the Pacific Drainage members of this genus. In the broadest view, it once ranged from southern British Columbia south to northernmost Baja California, eastward to western Wyoming, eastern Arizona and Chihuahua (Mexico), but this distribution probably includes records for other species (Taylor 1981, Nedeau et al. 2005) such as Anodonta nuttalliana. Taylor (1987) lists the species in 4 inch or greater depth pools in a spring complex above the North Fork of the East Fork of the Black River, Apache Co., Arizona. Clarke and Hovingh (1993) state that "as presently understood this species occurs in California, Nevada, Utah, and Arizona." and that the closely related Anodonta nuttalliana occurs in Oregon, Washington, and British Columbia. Preliminary analysis (K. Mock pers. comm. 2010) indicates Utah Anodonta are distinct from Anodonta oregonensis of the Pacific northwest and should tentatively be assigned to Anodonta californiensis pending future taxonomic work. Presently, Frest and Johannes (1995) report that the range has been reduced and extant populations are currently found in the following areas: the Middle Snake River in Idaho; the Fall and Pit rivers in Shasta County, California; the Okanogan river in Chelan County, Washington; and Roosevelt and Curlew lakes in Ferry County, Washington. No living specimens were found in the Willamette and lower Columbia rivers in searches by Frest and Johannes conducted from 1988-1990. Taylor (1981) reports that most of the natural populations in California have been eradicated and it is probably extinct in most of the Central Valley of southern California. In Utah, the only recent records are in two widely-spaced locations, Big Creek and Reddin Spring pond, but it may still be extant in the Raft River and portions of the Bear River drainage (Clarke and Hovingh 1993). It is extirpated from Utah Lake. Hovingh (2004) found it widely distributed in the Humboldt River drainage (Lahontan Basin) in northern Nevada, in the Bonneville Basin in Utah, Nevada, and Wyoming, and in the Malheur and Warner Basins in Oregon. Mock et al. (2005) list six sites in the Bonneville basin of Utah tentatively assigned to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Range is unclear due to taxonomic uncertainty with the Pacific Drainage members of this genus. In the broadest view, it once ranged from southern British Columbia south to northernmost Baja California, eastward to western Wyoming, eastern Arizona and Chihuahua (Mexico), but this distribution probably includes records for other species (Taylor, 1981; Nedeau et al., 2005) such as Anodonta nuttalliana. Taylor (1987) lists the species in 4 inch or greater depth pools in a spring complex above the North Fork of the East Fork of the Black River, Apache Co., Arizona. Clark and Hovingh (1993) state that "As presently understood this species occurs in California, Nevada, Utah, and Arizona." and that the closely related Anodonta nuttalliana occurs in Oregon, Washington, and British Columbia. Preliminary analysis (K. Mock, Utah State University, pers. comm.) indicates Utah Anodonta are distinct from Anodonta oregonensis of the Pacific northwest and should tentatively be assigned to Anodonta californiensis pending future taxonomic work. Presently, Frest and Johannes (1995) report the range has been reduced and extant populations are currently found in the following areas: the Middle Snake River in Idaho; the Fall and Pit rivers in Shasta County, California; the Okanogan river in Chelan County, Washington; and Roosevelt and Curlew lakes in Ferry County, Washington. No living specimens were found in the Willamette and lower Columbia rivers in searches by Frest and Johannes conducted from 1988-1990. Taylor (1981) reports that most of the natural populations in California have been eradicated and it is probably extinct in most of the Central Valley of southern California. In Utah the only recent records are in two widely-spaced locations, Big Creek and Reddin Spring pond, but it may still be extant in the Raft River and portions of the Bear River drainage (Clark and Hovingh, 1993). It is extirpated from Utah Lake. Hovingh (2004) found it widely distributed in the Humboldt River drainage (Lahontan Basin) in northern Nevada, in the bonneville Basin in Utah, Nevada, and Wyoming, and in the Malheur and Warner Basins in Oregon. Mock et al. (2005) list six sites in the Bonneville basin of Utah tentatively assigned to this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Anodonta californiensis Lea, 1852
Catalog Number: USNM 86393
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Locality: Colorado River, California, United States
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a low elevation species that is found in both lakes and lake-like stream environments (Frest and Johannes 1995).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This is a low elevation species that is found in both lakes and lake-like stream environments (Frest and Johannes, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: Number of occurrences (>20 but <100) uncertain. Beetle (1989) and Cvancara (2005) list the Bear River in Uinta Co., Wyoming. In Utah, 2 to 6 sites known from Utah, Millard, Rich, Tooele, and Box Elder Cos. (Oliver and Bosworth, 1999); with recent occurrences (tentatively A. californiensis) in Bear River, Redden Spring, Pruess Lake, Piute Reservoir, Otter Creek Reservoir, and Burriston Ponds (Mock et al., 2004). Mock et al. (2004) cite it (tentative A. californiensis) from the Black River, Apache, Arizona. Frest and Johannes (1995) report range reduced and extant in: Middle Snake River in Idaho; Fall and Pit Rivers in Shasta Co., California; Okanogan River in Chelan Co., Washington; and Roosevelt and Curlew Lakes in Ferry Co., Washington. No living specimens in the Willamette and lower Columbia rivers in searches by Frest and Johannes 1988-1990. Frest and Johannes (2000) list it as common locally in the Snake River and major tributaries. Taylor (1981) reports most California populations eradicated and likely extinct in most of the Central Valley. Currently in California, it is in the S Fork Eel, River, Lake Del Valle, Suisun Marsh, W Fork Walker River, Big Lake, Fall River, Tule River, Hat Creek, Russian River, Clear Lake, Pit and S Fork Pit River, Sacremento River, Donner Lake, Scott River, Lost River, Pajaro River, San Joaquin River, Dye Creek, Shasta River, Bridgeport Reservoir, Salton Sea, and Susan River (Howard, 2010). It was once throughout 6 major drainages in Arizona (incl. Lake Mead, Grand Canyon, Lower Colorado-Marble Canyon, Lower Lake Powell), but today only parts of the Black River drainage and Little Colorado River (Nedeau et al., 2005). In Utah the only recent records are widely spaced, Big Creek and Reddin Spring Pond, may be extant in the Raft River and portions of Bear River drainage (Clark and Hovingh, 1993). Hovingh (2004) found it widely distributed in the Humboldt River drainage (Lahontan Basin) in northern Nevada, Bonneville Basin in Utah, Nevada, and Wyoming, and Malheur and Warner Basins in Oregon. Also Nevada: Great Salt Lake, North Fork Humboldt, Truckee, and Carson Desert basins (NV NHP, pers. comm., 2007). Mock et al. (2004) found Bonneville Basin (Utah) population cluster with A. oregonensis from adjacent Lahontan Basin (surveyed in Elko, Nevada) and the Middle Snake/Powder basin (Baker Co., Oregon). Mock et al. (2004) differentiated Glenn and Solano Co., California, as A. wahlamatensis thereby limiting A. californiensis populations to Utah (see above) and Arizona (Black River in Apache). In Oregon, several populations recently found in the Middle Fork John Day River and lower mainstem Umatilla River, but ID not possible (Brim Box et al., 2003; 2006), evidence indicates John Day River population includes A. californiensis/nuttalliana clade and Umatilla River population include A. oregonensis/kennerlyi and A. californiensis/nuttalliana clades in sympatry (K. Mock, UT State U., pers. comm., 2007). Chong et al. (2008) utilized specimens from the East Fork Black River, Arizona, in their phylogenetic study. Recent Washington records are mainly from the Columbia and Okanogan Rivers and some ponds adjacent to the Columbia River (Nedeau et al., 2005). In Arizona, Bequaert and Miller (1973) list the Lower Colorado, San Pedro-Wilcox, Chevelon, and Little Colorado drainages (historical) and only recent in the Black River drainage. Historically in Arizona, it was in most drainages including the Black, Salt, Santa Cruz, Verde, Gila and Colorado Rivers, but today only the upper Black River in the the Apache-Sitgreaves National Forest to at least the White Mountain Apache Reservation (AZ NHP, pers. comm., 2007). It may be extant on Chevelon Creek according to Landye (1988). Lysne and Clark (2009) found it in the Bruneau River, Idaho.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: In a survey streams in California, approximately 8000 individuals were found in the upper reaches of the Eel River (none in Ten Mile, Elder, or Fox Creeks), restricted to the lower 2 km of the upper portion of the river (Cuffey, 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

d'Eliscu (1972) reported the mosquitofish, Gambusia affinis, as a glochidial host in laboratory testing.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anodonta californiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGCGTTGGTTGTTTTCTACAAATCATAAGGACATTGGAAGGTTGTATTTATTCTCATCTTTGTGGTGAGGTTTGGTTGGATTATCTTTAAGAATTCTTATTCGAGTAGAGTTAGCGCAACCTGGTGGTGTTATAGCTGAT---GAGCAGCTATACTATTCTATTGTTACAGCTCATGCTTTTGTAATAATCTTTTTTACTGTTATACCCGCTATAATAGGTGGTTTGGGGAATTGACTTGTGCCACTTATGATTGGGTGTCCTGACATAGCTTTTCCTCGTTTAAATAATATTAGATTCTGACTGTTATGTGGTTCTGGGTTTTTATTAGCATGGTCTATACTTGTGGAAGGAGGTTGTGGAACTGGATGGACTATTTATCCACCTTTGTCTAATAAAGTTTCTCATTCGAGAGTAGCTGTTGATGTGGTTATTTTTTCTTTACATTTAGCCGGTATTTCATCAATTCTTGGGTCAGTAAACTTTATTACTACTATTATAAACATGCGTGCTGGTGTTATACGGGCTGAGCGTATTCCATTGTTTGTGTGATCTATTTTATGCACAGCAAGTTTGGTGCTGGCGTCTTTTCCCGTATTAGCAGGTGCTATTACTATGTTGTTAACTGATCGCAATTTTAATACTTCTTTTTTTGACCCAAGGGGGGGGGGT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anodonta californiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Cummings, K. & Cordeiro, J.

Reviewer/s
Böhm, M. & Collen, B.

Contributor/s
Dyer, E., Soulsby, A.-M., Whitton, F., McGuinness, S., De Silva, R., Milligan, H.T., Kasthala, G., Thorley, J., Herdson, R., McMillan, K. & Collins, A.

Justification
Anodonta californiensis has been assessed as Least Concern due to its widespread distribution. This species was once thought to have been widespread in the Pacific Drainage from British Columbia into Mexico, but there is considerable taxonomic confusion as to the placement of the western North American Anodonta species. The current range however is patchy, and it has apparently disappeared from the Central Valley in California. Extant occurrences in the Columbia and Snake river systems are threatened by river impoundment. If this species turns out to be a composite, its conservation status would require reassessment.

History
  • 1996
    Not Evaluated
  • 1994
    Indeterminate
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: This species was once thought to have been widespread in the Pacific Drainage from British Columbia into Mexico, but there is considerable taxonomic confusion as to the placement of the western North American Anodonta species. The current range however is patchy, and it has apparently disappeared from the Central Valley in California. Extant occurrences in the Columbia and Snake river systems are threatened by river impoundment. If this species turns out to be a composite, its conservation status would require re-evaluation.

Intrinsic Vulnerability: Highly vulnerable

Comments: Mock et al. (2004) found populations of Anodonta (tentatively Anodonta californiensis but further taxonomic study could reveal them to be Anodonta oregonensis or Anodonta wahlamatensis) from the Bonneville Basin of Utah were strongly structured with little or no recent gene flow among extant populations that are currently hydrologically separated.

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Comments: It can tolerate some water pollution, but not heavy nutrient enhancement (Frest and Johannes, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Due to taxonomic uncertainty, it is difficult to determine the number of occurrences for this species (probably more than twenty but less than 100). Beetle (1989) lists the Bear River in Uinta Co., Wyoming. In Utah, occurrences (between two and six) are known from Utah, Millard, Rich, Tooele, and Box Elder Cos. (Oliver and Bosworth 1999). These sites were resurveyed recently and extant populations (tentatively Anodonta californiensis) were found in Bear River, Redden Spring, Pruess Lake, Piute Reservoir, Otter Creek Reservoir, and Burriston Ponds, all in Utah (Mock et al. 2004). Mock et al. (2004) also cite specimens tentatively identified as A. californiensis from the Black River, Apache, Arizona. Frest and Johannes (1995) report that the range has been reduced and extant populations are found in: the Middle Snake River in Idaho; the Fall and Pit Rivers in Shasta Co., California; the Okanogan river in Chelan Co., Washington; and Roosevelt and Curlew Lakes in Ferry Co., Washington. No living specimens were found in the Willamette and lower Columbia rivers in searches by Frest and Johannes from 1988-1990. Frest and Johannes (2000) list it as common locally in the Snake River and major tributaries. Taylor (1981) reports most California populations as eradicated and the species is probably extinct in most of the Central Valley. It was once distributed throughout six major drainages in Arizona (including Lake Mead, Grand Canyon, Lower Colorado-Marble Canyon, Lower Lake Powell), but today is only in portions of the Black River drainage and Little Colorado River (Nedeau et al. 2005). In Utah, the only recent records are widely spaced, in Big Creek and Reddin Spring Pond, but it may still be extant in the Raft River and portions of the Bear River drainage (Clarke and Hovingh 1993). Hovingh (2004) found it widely distributed in the Humboldt River drainage (Lahontan Basin) in northern Nevada, the Bonneville Basin in Utah, Nevada, and Wyoming, and the Malheur and Warner Basins in Oregon. Other Nevada occurrences are in the Great Salt Lake, North Fork Humboldt, Truckee, and Carson Desert basins (NV NHP pers. comm. 2007). Mock et al. (2004), in an analysis of genetic diversity, found the Bonneville Basin (Utah) population cluster with Anodonta oregonensis from the adjacent Lahontan Basin (surveyed in Elko, Nevada) and the Middle Snake/Powder basin (Baker Co., Oregon). Mock et al. (2004) further differentiated Glenn and Solano Co., California, specimens as Anodonta wahlamatensis, thereby limiting Anodonta californiensis populations to Utah (see above) and Arizona (Black River in Apache). In Oregon, several populations were recently found in the Middle Fork John Day River and the lower main stem Umatilla River, but due to taxonomic confusion, identification beyond genus was not possible (Brim Box et al. 2006); however, preliminary evidence indicates the John Day River population includes the A. californiensis/nuttalliana clade and the Umatilla River population include both A. oregonensis/kennerlyi and A. californiensis/nuttalliana clades in sympatry (K. Mock, Utah State University, pers. comm. 2007). Chong et al. (2008) utilized specimens from the East Fork Black River, Arizona, in their phylogenetic study. Recent Washington records are mainly from the Columbia and Okanogan Rivers and some ponds adjacent to the Columbia River (Nedeau et al. 2005). In Arizona, Bequaert and Miller (1973) list the Lower Colorado, San Pedro-Wilcox, Chevelon, and Little Colorado drainages as historical with the only recent occurrence in the Black River drainage. Historically in Arizona, it was found in most drainages including the Black, Salt, Santa Cruz, Verde, Gila and Colorado Rivers, but today it is only found in the upper Black River in the the Apache-Sitgreaves National Forest to at least the White Mountain Apache Reservation (AZ NHP pers. comm. 2007). A population may be extant on Chevelon Creek according to Landye (1981).

In a survey of streams in California, approximately 8,000 individuals were found in the upper reaches of the Eel River (none in Ten Mile, Elder, or Fox Creeks), restricted to the lower 2 km of the upper portion of the river (Cuffey 2002).

Frest and Johannes (1995) report that the species is declining in terms of area occupied and the number of sites and individuals, and local declines have been observed throughout the range (Mock et al. 2010). It is generally widely distributed, though scarce; it is likely extirpated from the Colorado River basin in Arizona and Death Valley Basin, Los Angeles Basin, and Central Valley in Caifornia (Hovingh 2004). A recent survey of 115 sites in the Plumas, Tahoe, and Eldorado National Forests plus Lake Tahoe Basin management unit found no Anodonta specimens (in 70+ streams) except a few whole shells at 15 m depth in Donner Lake despite historical occurrences there (Howard 2008). The species is declining (possibly extirpated) in Utah with historic populations only in the Raft River (Box Elder Co.), Utah Lake (Utah Co.), and Bear Lake (Rich Co.) (Oliver and Bosworth, 1999). It is nearly extirpated from Arizona and has disappeared from the Sacramento River system. In Canada, this species occurs in British Columbia where it is declining (Metcalfe-Smith and Cudmore-Vokey 2004). Regardless of the taxonomic outcome of analysis of Anodonta molecular phylogeny, it is widely recognized that Anodonta in the western U.S. are in decline (Mock et al. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-50%

Comments: Frest and Johannes (1995) report it is declining in terms of area occupied and number of sites and individuals. Widely distributed though scarce; likely extirpated from the Colorado River basin in Arizona and Death Valley Basin, Los Angeles Basin, and Central Valley in Caifornia (Hovingh, 2004). It appears all mussels are extirpated from southern California, south of Santa Cruz (Howard, 2010). A recent survey of 115 sites in the Plumas, Tahoe, and Eldorado National Forests plus Lake Tahoe Basin management unit found no Anodonta specimens (0 of 70+ streams) except a few whole shells at 15 m depth in Donner Lake despite historical occurrences there (Howard, 2008). The species is declining (possibly extirpated) in Utah with historic populations only in the Raft River (Box Elder Co.), Utah Lake (Utah Co.), and Bear Lake (Rich Co.) (Oliver and Bosworth, 1999). It is nearly extirpated from Arizona and has disappeared from the Sacramento River system. In Canada, this species occurs in British Columbia where it is declining (Metcalfe-Smith and Cudmore-Vokey, 2004). Regardless of the taxonomic outcome of analysis of Anodonta molecular phylogeny, it is widely recognized that Anodonta in the western U.S. are in decline (Mock et al., 2004).

Global Long Term Trend: Decline of 30-50%

Comments: Range has been drastically reduced and the species has become extirpated from much of Utah, the Sacramento River system, and most of Arizona.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats to this species includes pollution; diversion of rivers for irrigation, hydroelectric, and water supply projects; elimination of natural fish hosts; eutrophication due to agricultural run-off and urbanization; impoundments. The species can tolerate some water pollution, but not heavy nutrient enhancement (Frest and Johannes 1995).

Mock et al. (2004) found that populations of Anodonta (tentatively Anodonta californiensis but further taxonomic study could reveal them to be Anodonta oregonensis or Anodonta wahlamatensis) from the Bonneville Basin of Utah were strongly structured with little or no recent gene flow among extant populations which are currently hydrologically separated. This fragmentation makes the populations vulnerable to threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Unknown

Comments: Threats include pollution; diversion of rivers for irrigation, hydroelectric, and water supply projects; elimination of natural fish hosts; eutropification due to agricultural runoff and urbanization; impoundments.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species breaks into eight conservation units based on available genetic data. These subclades can be considered evolutionarily significant units and all populations (with the exception of AOC and APR) could be considered distinct management units (Mock et al. 2010). However, no specific conservation actions have been undertaken. Some conservation units would potentially require careful monitoring (A.Bogan pers. comm. 2010). Further research is necessary regarding this species' taxonomy, population trends, ecology and impacting threats. Future monitoring of population trends and the implementation of conservation policies are required in order to protect this species from future declines. Ex-situ conservation could play a part in species recovery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Nonnative species are frequently the target of eradication efforts in the western U.S., but they may be serving as host fish for species in the western Anodonta complex in the absence of native host fish and fish stockign may result in unwanted gene flow between geographically disjunct populations. Broad scale analyses of genetic and mophological variation among Anodonta in western North America is necessary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Since the time of Call (1884) there has been much confusion regarding the taxonomic status of this and other floaters (Anodonta) of western North America. Isaac Lea (1838) described Anodonta wahlametensis, Anodonta nuttalliana, and Anodonta oregonensis from the same site ("Wahlamet [Willamette River], near its junction with the Columbia River [Oregon]") all in the same publication. Under the Rule of First Revisor (ICZN), Call (1884) considered Anodonta nuttalliana to include, as synonyms, Anodonta wahlametensis, Anodonta oregonensis, and Anodonta californiensis. Call (1884) considered Anodonta nuttalliana to include, as synonyms, Anodonta wahlametensis, Anodonta oregonensis, and Anodonta californiensis. Recent authors (e.g., Burch, 1975, Clarke, 1981; Turgeon et al., 1998), however, have considered A. californiensis, A. nuttalliana, and A. oregonensis to be distinct. Some authors even continue to recognize Anodonta wahlamatensis as a distinct species (Frest and Johannes, 1995; Taylor, 1981; Henderson, 1929) while most place it in the synonymy of A. nuttaliana (Burch, 1975; Turgeon et al., 1998). Whether A. wahlamatensis should be removed from the synonymy of A. nuttalliana will depend on future anatomical and genetic work on western Anodonta. According to T. Frest, Anodonta nuttalliana has been revised to the following; Anodonta nuttalliana nuttalliana and Anodonta nuttalliana wahlametensis = Anodonta wahlametensis, and, Anodonta nuttalliana idahoensis and Anodonta nuttalliana californiensis = Anodonta californiensis (pers. comm. Amy Stock, WA-NHP, 1996). Considerable taxonomic confusion surrounds this species complex. Mock et al. (2004; 2005) found a lack of resolution (very little nuclear diversity) in phylogenetic reconstructions of Anodonta (A. californiensis, A. oregonensis, A. wahlamatensis) populations in the Bonneville Basin, Utah, but there was a tendency for the Bonneville Basin Anodonta (tentatively A. californiensis) to cluster with A. oregonensis from the adjacent Lahontan Basin in Nevada. Recently, Zanatta et al. (2007) supported the monophyly of both Pyganodon and Utterbackia using mutation coding of allozyme data, but also resolved the Eurasian Anodonta cygnea to Pyganodon, Utterbackia, and North American Anodonta; indicating futher phylogenetic analysis of the Anodontinae is required including both North American and Eurasian species. In a phylogenetic analysis of western North American Anodonta using topotypic material as was available, Chong et al. (2008) found three deeply divided lineages: one clade including Anodonta oregonensis and Anodonta kennerlyi, one clade including Anodonta californiensis and Anodonta nuttalliana, and one clade including Anodonta beringiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!