Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (1000-5000 square km (about 400-2000 square miles)) Historic distribution includes the Lower Willamette River, and lower Columbia River in Oregon and Washington, and in northern California down to the San Joaquin Valley (Frest and Johannes, 1995; Taylor, 1981; Henderson, 1929). Frest and Johannes (1995) cite original distribution as the Lower Willamette River, and lower Columbia River in Oregon and Washington from The Dalles to the mouth; and in larger slow streams of northern California as far south as the northern San Joaquin Valley (including Wahkiikum, Cowlii, Clark, Skamania, and Klickitat Cos., Washington; Clatsop, Columbia, Multnomah, Clackamas, Marion, Hood River, and Wasco Cos., Oregon; and Siskiiou, Shasta, Lassen, Modoc, Tehama, Glenn, Butte, Yuba, Sutter, Yolo, and Sacramento watersheds., California). Currently, it is thought to be restricted to the Fall River in California and one possible specimen was reported from The Dalles (Wasco Co., Oregon) in 1990 (Frest and Johannes, 1995). Frest and Johannes (1995) notes it could also be surviving in other areas with deep pools and oxygenated substrates. Mock et al. (2004) further differentiated Glenn and Solano Co., California, specimens as Anodonta wahlamatensis thereby limiting Anodonta californiensis populations to Utah and Arizona (Black River in Apache).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Distribution is confusing as many historical records easily confuse this species with the other western Anodonta, however, it is believed to occur in California, Oregon, Washington, and southern British Columbia (Nedeau et al., 2005) but also east to Utah (Burch, 1975) with Idaho records (Henderson, 1924; 1936) records believed to be Anodonta kennerlyi. Preliminary analysis (K. Mock, Utah State University, pers. comm.) indicates Utah Anodonta are distinct from Anodonta oregonensis of the Pacific northwest and should tentatively be assigned to Anodonta californiensis pending future taxonomic work. Clarke (1981) cites distribution as the Fraser and Columbia River systems in southern British Columbia (absent from Vancouver Island) and south to central California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Type Information

Holotype for Anodonta (Anodonta) nuttalliana Lea, 1838
Catalog Number: USNM 86391
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): T. Nuttall
Locality: Wahlamat River, Near Its Junction With Columbia River, Oregon, United States
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species occurs in rivers and lakes on muddy and sandy bottoms (Clarke, 1981), especially low gradient, low elevation areas of coastal watersheds (Nedeau et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species occurs in rivers and lakes on muddy and sandy bottoms (Clarke, 1981), especially low gradient, low elevation areas of coastal watersheds (Nedeau et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 80

Comments: Mock et al. (2004) cite collected specimens tentatively identified as Anodonta cf. wahlametensis from the Sacramento River, Glenn Co., California, and Union Creek, Solano Co., California. In Oregon, several populations of Anodonta were recently confirmed in the Middle Fork John Day River and the lower main stem of the Umatilla River, but due to the taxonomic confusion surrounding the western Anodonta, identification to species level was not attempted (Brim Box et al., 2003; 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: There is considerable disagreement as to the validity of this taxon. If valid, all historic populations (approximately 6 or more) of this species are extirpated in Utah since before 1940. Collected specimens, however, may prove to be Anodonta californiensis following taxonomic analysis (Oliver and Bosworth, 1999). Preliminary analysis (K. Mock, Utah State University, pers. comm.) indicates Utah Anodonta are distinct from Anodonta oregonensis of the Pacific northwest and should tentatively be assigned to Anodonta californiensis pending future taxonomic work. In Canada, it is somewhat common in British Columbia but little concise locality information is available (Metcalfe-Smith and Cudmore-Vokey, 2004), however it is now believed records of what was formerly attributed to Anodonta californiensis in British Columbia is now considered Anodonta nuttalliana (BC CDC, pers. comm., 2009). In Oregon, several populations of Anodonta were recently confirmed in the Middle Fork John Day River and the lower main stem of the Umatilla River, but due to the taxonomic confusion surrounding the western Anodonta, identification to species level was not attempted (Brim Box et al., 2003; 2006), although preliminary evidence indicates the John Day River population includes A. californiensis/nuttalliana clade and the Umatilla River population include both A. oregonensis/kennerlyi and A. californiensis/nuttalliana clades in sympatry (K. Mock, Utah State University, pers. comm., 2007). Specimens have also been confirmed in the Upper Quinn and Middle Owyhee drainages in Nevada/Oregon (K. Mock, Utah State University, pers. comm., 2007). Chong et al. (2007) used specimens from near the Columbia/Willamette confluence (Bybee Lake and the Columbia Slough). Museum specimens (UMMZ) exist for California (San Juaquin River in San Juaquin Co., Coyote Creek in San Jose Co., San Juan Tequesquito Creek in San Benito Co., Clear Lake in Lake Co., Sacramento River in Sacramento Co., North Fork Pit River in Modoc Co.), Utah (Salt Lake City canal, Warm Spring Lake, and Jordan River in Salt Lake Co., Utah Lake in Utah Co., Willow Springs in Tooele Co., Sevier River in Millard Co.), Oregon (Klamath Lake in Klamath Co.), Nevada (Humboldt River in Elko Co., Pyramid Lake in Washoe Co.), and British Columbia (Sumas and Harrison Lakes).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Population size is not known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Little is known about life history and glochidial host is unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about life history and the glochidial host is unknown. They are probably long-term brooders as gravid females have been observed in October (Nedeau et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anodonta nuttalliana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGTACTTTATACTTACTTTTTGCTCTGTGGTCTGGATTGATTGGGTTGGCTTTAAGGCTGTTAATTCGAGCTGAGTTGGGTCAACCTGGAAGATTATTGGGAGAT---GATCAGTTATACAATGTAATTGTTACGGCTCATGCTTTCATGATAATTTTTTTCTTGGTAATACCAATGATGATTGGTGGATTCGGTAATTGATTGATTCCTTTGATAATTGGTGCTCCTGATATGGCTTTTCCTCGGTTAAATAATTTAAGGTTTTGATTACTTGTGCCAGCTTTGTTTTTGTTATTAAGCTCTTCATTAGTGGAGAGTGGTGTTGGTACTGGTTGGACGGTATATCCACCTTTATCTGGAAATGTTGCTCATTCTGGGGCTTCTGTGGATTTGGCCATTTTTTCTTTACATCTTGCTGGTGCTTCTTCAATTCTGGGGGCTATTAATTTTATTTCTACTGTTGGAAACATGCGATCTCCTGGTTTGGTCGCTGAGCGAATTCCTTTATTTGTTTGGGCTGTTGCCGTTACAGCTGTGTTATTAGTTGCTGCTTTACCAGTTTTAGCTGGTGCTATTACAATGCTGTTGACGGATCGTAATTTAAACACTTCATTTTTTGAGCCTACAGGGGGAGGGGATCCTATTTTGTATATACATTTGTTTTGATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anodonta nuttalliana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: Pending taxonomic placement, this is a regional endemic where populations may be reduced to only one river system in California and one on the Oregon/Washington border. Taxonomic confusion exists, however, as it may be a synonym of the much more widespread, Anodonta nuttalliana.

Intrinsic Vulnerability: Highly vulnerable

Comments: Mock et al. (2004) found populations of Anodonta (tentatively Anodonta californiensis but further taxonomic study could reveal them to be Anodonta oregonensis or Anodonta wahlamatensis) from the Bonneville Basin of Utah were strongly structured with little or no recent gene flow among extant populations that are currently hydrologically separated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Distribution is confusing as many historical records easily confuse this species with the other western Anodonta, however, it is believed to occur in California, Oregon, Washington, and across southern British Columbia (north to 52 degrees N latitude) except Vancouver Island )but also east to Utah (where it may be extirpated) with Idaho records believed to be Anodonta kennerlyi. British Columbia records for Anodonta californiensis are now believed to be applicable to this species. A proper conservation assessment requires further taxonomic study clarifying the placement of western Anodonta species, all of which are largely in decline with local extirpations and range-wide reductions.

Intrinsic Vulnerability: Unknown

Comments: Mock et al. (2004) found populations of a related Anodonta (tentatively Anodonta californiensis but further taxonomic study could reveal them to be Anodonta oregonensis or Anodonta wahlamatensis) from the Bonneville Basin of Utah were strongly structured with little or no recent gene flow among extant populations that are currently hydrologically separated.

Environmental Specificity: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-50%

Comments: Regardless of the taxonomic outcome of analysis of Anodonta molecular phylogeny, it is widely recognized that Anodonta in the western U.S. are in decline (Mock et al., 2004).

Global Long Term Trend: Decline of 50-70%

Comments: If the Anodonta of the central valley of California is, in fact, this species, it has experienced significant decline historically.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-50%

Comments: A recent survey of 115 sites in the Plumas, Tahoe, and Eldorado National Forests plus Lake Tahoe Basin management unit found no Anodonta specimens (0 of 70+ streams) except a few whole shells at 15 m depth in Donner Lake despite historical occurrences there (Howard, 2008). Regardless of the taxonomic outcome of analysis of Anodonta molecular phylogeny, it is widely recognized that Anodonta in the western U.S. are in decline (Mock et al., 2004; Chong et al., 2008).

Global Long Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Pollution; diversion of rivers for irrigation, hydroelectric, and water supply projects; elimination of natural fish hosts; eutropification due to agricultural runoff and urbanization; impoundments.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Medium

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Nonnative species are frequently the target of eradication efforts in the western U.S., but they may be serving as host fish for species in the western Anodonta complex in the absence of native host fish and fish stockign may result in unwanted gene flow between geographically disjunct populations. Broad scale analyses of genetic and mophological variation among Anodonta in western North America is necessary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Nonnative species are frequently the target of eradication efforts in the western U.S., but they may be serving as host fish for species in the western Anodonta complex in the absence of native host fish and fish stockign may result in unwanted gene flow between geographically disjunct populations. Broad scale analyses of genetic and mophological variation among Anodonta in western North America is necessary.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Recently, Zanatta et al. (2007) supported the monophyly of both Pyganodon and Utterbackia using mutation coding of allozyme data, but also resolved the Eurasian Anodonta cygnea to Pyganodon, Utterbackia, and North American Anodonta; indicating futher phylogenetic analysis of the Anodontinae is required including both North American and Eurasian species. Since the time of Call (1884) there has been much confusion regarding the taxonomic status of this and other floaters (Anodonta) of western North America. Isaac Lea (1838) described Anodonta wahlametensis, Anodonta nuttalliana, and Anodonta oregonensis from the same site ("Wahlamet [Willamette River], near its junction with the Columbia River [Oregon]") all in the same publication. Under the Rule of First Revisor (ICZN), Call (1884) considered Anodonta nuttalliana to include, as synonyms, Anodonta wahlametensis, Anodonta oregonensis, and Anodonta californiensis. Recent authors (e.g., Burch, 1975, Clarke, 1981; Turgeon et al., 1998), however, have considered A. californiensis, A. nuttalliana, and A. oregonensis to be distinct. Some authors even continue to recognize Anodonta wahlamatensis as a distinct species (Frest and Johannes, 1995; Taylor, 1981; Henderson, 1929) while most place it in the synonymy of A. nuttaliana (Burch, 1975; Turgeon et al., 1998). Whether A. wahlamatensis should be removed from the synonymy of A. nuttalliana will depend on future anatomical and genetic work on western Anodonta. According to T. Frest, Anodonta nuttalliana has been revised to the following; Anodonta nuttalliana nuttalliana and Anodonta nuttalinaa wahlametensis = Anodonta wahlametensis, and, Anodonta nuttalliana idahoensis and Anodonta nuttalliana californiensis = Anodonta californiensis (pers. comm. Amy Stock, WA-NHP, 1996). Considerable taxonomic confusion surrounds this species complex. Mock et al. (2004; 2005) found a lack of resolution (very little nuclear diversity) in phylogenetic reconstructions of Anodonta (A. californiensis, A. oregonensis, A. wahlamatensis) populations in the Bonneville Basin, Utah, but there was a tendency for the Bonneville Basin Anodonta (tentatively A. californiensis) to cluster with A. oregonensis from the adjacent Lahontan Basin in Nevada. In a phylogenetic analysis of western North American Anodonta using topotypic material as was available, Chong et al. (2008) found three deeply divided lineages: one clade including Anodonta oregonensis and Anodonta kennerlyi, one clade including Anodonta californiensis and Anodonta nuttalliana, and one clade including Anodonta beringiana; molecular and morphological data supporting synonymy of Anodonta wahlametensis with A. nuttalliana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Recently, Zanatta et al. (2007) supported the monophyly of both Pyganodon and Utterbackia using mutation coding of allozyme data, but also resolved the Eurasian Anodonta cygnea to Pyganodon, Utterbackia, and North American Anodonta; indicating futher phylogenetic analysis of the Anodontinae is required including both North American and Eurasian species. Since the time of Call (1884) there has been much confusion regarding the taxonomic status of this and other floaters (Anodonta) of western North America. Isaac Lea (1838) described Anodonta wahlametensis, Anodonta nuttalliana, and Anodonta oregonensis from the same site ("Wahlamet [Willamette River], near its junction with the Columbia River [Oregon]") all in the same publication. Under the Rule of First Revisor (ICZN), Call (1884) considered Anodonta nuttalliana to include, as synonyms, Anodonta wahlametensis, Anodonta oregonensis, and Anodonta californiensis. Call (1884) considered Anodonta nuttalliana to include, as synonyms, Anodonta wahlametensis, Anodonta oregonensis, and Anodonta californiensis. Recent authors (e.g., Burch, 1975, Clarke, 1981; Turgeon et al., 1998), however, have considered A. californiensis, A. nuttalliana, and A. oregonensis to be distinct. Some authors even continue to recognize Anodonta wahlamatensis as a distinct species (Frest and Johannes, 1995; Taylor, 1981; Henderson, 1929) while most place it in the synonymy of A. nuttaliana (Burch, 1975; Turgeon et al., 1998). Whether A. wahlamatensis should be removed from the synonymy of A. nuttalliana will depend on future anatomical and genetic work on western Anodonta. According to T. Frest, Anodonta nuttalliana has been revised to the following; Anodonta nuttalliana nuttalliana and Anodonta nuttalinaa wahlametensis = Anodonta wahlametensis, and, Anodonta nuttalliana idahoensis and Anodonta nuttalliana californiensis = Anodonta californiensis (pers. comm. Amy Stock, WA-NHP, 1996). Considerable taxonomic confusion surrounds this species complex. Considerable taxonomic confusion surrounds this species complex. Mock et al. (2004; 2005) found a lack of resolution (very little nuclear diversity) in phylogenetic reconstructions of Anodonta (A. californiensis, A. oregonensis, A. wahlamatensis) populations in the Bonneville Basin, Utah, but there was a tendency for the Bonneville Basin Anodonta (tentatively A. californiensis) to cluster with A. oregonensis from the adjacent Lahontan Basin in Nevada. In a phylogenetic analysis of western North American Anodonta using topotypic material as was available, Chong et al. (2008) found three deeply divided lineages: one clade including Anodonta oregonensis and Anodonta kennerlyi, one clade including Anodonta californiensis and Anodonta nuttalliana, and one clade including Anodonta beringiana.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!