Overview

Distribution

Range Description

Burch (1975) cites distribution as Kamchatka (eastern Asia); Alaska; the whole Yukon River system of Alaska and Yukon Territory; Washington, Oregon, and possibly (not likely) California. Washington and Oregon records (Puget Sound, Upper Klamath Lake, Ten Mile Lake in Coos Bay, Flores Lake south of Bandon, Green Lake in Seattle, Skookumchuck River, Scatter Creek, Crescent Lake, Lake Leland, Whatcom Lake) are all historical and are derived from Henderson (1929). In Alaska, this species occurs from the Aleutian Islands and southwestern Alaska to northern and central interior and into the upper Yukon River drainage and Old Crow Basin, Yukon Territory (Clarke 1981, Nedeau et al. 2005). It may also occur in Oregon, California and Washington (Henderson 1929, Ingram 1948), but sites need verification (T. Frest pers. comm. 2003). It has also been reported from Kamchatka, Russia (Baxter 1983, Clarke 1981, Nedeau et al. 2005). In Russia, the species is known from Kamchatka and Chukotka peninsulas, northern part of Magdadan region and from Kurile Archipelago (Paramushir Island) (Zatrawkin and Bogatov 1987, Saenko et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) Burch (1975) cites distribution as Kamchatka (eastern Asia); Alaska; the whole Yukon River system of Alaska and Yukon Territory; Washington, Oregon, and possibly (not likely) California. Washington and Oregon records (Puget Sound, Upper Klamath Lake, Ten Mile Lake in Coos Bay, Flores Lake south of Bandon, Green Lake in Seattle, Skookumchuck River, Scatter Creek, Crescent Lake, Lake Leland, Whatcom Lake) are all historical and are derived from Henderson (1929). In Alaska, this species occurs from the Aleutian Islands and southwestern Alaska to northern and central interior and into the upper Yukon River drainage and Old Crow Basin, Yukon Territory (Clarke, 1981; Nedeau et al., 2005). It may also occur in Oregon, California and Washington (Henderson, 1929; Ingram, 1948), but sites need verification (T. Frest, pers. comm., 2003). It has also been reported from Kamchatka, Russia (Baxter, 1983; Clarke, 1981; Nedeau et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Anodonta beringiana Middendorff, 1851
Catalog Number: USNM 218915
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): Winecoff
Locality: Fort Yukon, Alaska, United States
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The distribution and abundance of this species is closely linked to the population dynamics of its hosts. The species has a range of fish hosts with most recent discoveries including the ninespine stickleback, Pungitius pungitius, and nonandadromous Kokanee salmon, Oncorhynchus nerka. This species is long lived (20-40+ year lifespan) and is found in slow moving streams, ponds, or lakes with a sand or gravel substrate. As a filtter feeder of zooplankton, phytoplankton and bacteria, it requires water free of large amounts of sediment in order to feed (NatureServe 2009).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species prefers lakes, ponds or slow-moving streams with sand and gravel substrate and a depth of around 1 m (Hart and Fuller, 1974; D.G. Smith, pers. comm., 2004; Nedeau et al., 2005). it requires abundant dissolved oxygen and water relatively free of silt (including glacial till), which can smother mussels (Hart and Fuller, 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: A filter feeder of decaying tissue and detritus including zooplankton, phytoplankton and bacteria (Hart and Fuller 1974). Requires water free of large amounts of sediment to feed (Stein 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 to >300

Comments: In Oregon, several populations of Anodonta were recently confirmed in the Middle Fork John Day River and the lower main stem of the Umatilla River, but due to the taxonomic confusion surrounding the western Anodonta, identification to species level was not attempted (Brim Box et al., 2003; 2006). In Canada, this species may occur in the Yukon and British Columbia (Clarke, 1981), but no recent records are available (Metcalfe-Smith and Cadmore-Vokey, 2004). It is also known from Alaska, the Aleutian Islands, and drainages in Kamchatka, USSR (Clarke, 1981; Nedeau et al., 2005). In Alaska, it was described most likely from somewhere in eastern Siberia and Alaska (Chong et al., 2008), and it occurs from the Aleutian Islands and southwestern Alaska to northern and central interior and into the Upper Yukon River drainage (Clarke, 1981; Baxter, 1983; 1987); generally north of 61 degrees latitude. Chong et al. (2008) utilized specimens from Waldron Lake in Anchorage, Alaska, for their phylogenetic study. Museum specimens (UMMZ) exist for Washington (Lake Quiniult in Grays Harbor, Pleasant Lake in Clallam Co., Whatcom Falls and Lake Whatcom in Whatcom Co., an unnamed slough in King, Beaver and Cain Lakes in Skagit Co.), Alaska (Heckman Lake), and Oregon (upper Klamath Lake in Klamath Co., Floras Lake in Coos Co., Rhett Lake on the California border). University of Alaska museum records include Yukon, Kuskokwim, Kobuk, Coville, and Copper River drainages in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: When found this species is often very abundant, providing a stable source of food for otter and muskrat (Nedeau et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Unknown, but spawning likely corresponds to migrations of anadromous host fish to streams and lake outlets (Smith pers. comm. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Adult males release sperm into the water, which are drawn up by the female through incurrent siphon to fertilize eggs. Process relies on slight water current to occur, and where currents are reduced, egg fertilization is less likely to occur (Hart and Fuller 1974). Fertilized eggs are incubated in portions of the female gills, then hatched larvae (glochidia) are released into the water and attach themselves parasitically to host fish (Stein 1971). It is unknown whether A. beringiana is a tachytictic (female releases glochidia as soon as they hatch into mature larvae) or bradytictic spawner (female retains glochidia after they mature and releases them sometime later, often holding them through the fall/winter season to release in the spring), but glochidia are often found attached to host fish from May-August (Cope 1959, Smith pers. comm. 2004). Throughout its range, larvae are obligate parasites of three known species of fish: anadromous sockeye salmon (Oncorhynchus nerka), Chinook salmon (Oncorhynchus tshawytscha), and threespine stickleback (Gasterosteus aculeatus) (Cope, 1959; Hart and Fuller, 1974). Mature larvae (glochidia) are released from marsupial brooding compartments in female gills into water column when light-sensitive mantle-spots are stimulated or by changes in water temperature (Clarke 1981). Glochidia are not free-swimming and depend on the host fish for dispersal once they have infected it. Glochidia sustain nourishment from the host using a thread gland and are protected from bacterial attack and predation while they metamorphose into juvenile mussels. As juveniles, use a byssal thread to anchor in suitable substrate, where they grow and mature (Hart and Fuller 1974).

Recent discoveries of several new species of host fish parasitized (ninespine stickleback, Pungitius pungitius, and nonanadromous Kokanee salmon, Oncorhynchus nerka), in Alaska, raise questions about host specificity in this mussel and encourage study of other fish inhabitants of its range (Miller, pers. comm., 2004; D.G. Smith pers. comm. 2004). Since this species requires larval infection of host fish species for dispersal, its abundance and distribution are closely linked to population dynamics of its hosts. This species is a good indicator of environmental contaminants because it is long-lived (20-40+ year lifespan) (Stein, 1971) and bio-concentrates filtered substances in its shell. Freshwater mussels were an important natural resource for native Alaskans, who used them for food, tools and jewelry (Williams and Neves, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Anodonta beringiana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTGGTACTTTATATTTATTGTTGGCTTTGTGGTCTGGTTTAATTGGGTTAGCTTTAAGCTTGTTAATTCGAGCAGAGTTAGGTCAGCCTGGAAGGCTATTGGGGGAC---GATCAGCTATATAATGTTATCGTTACGGCTCATGCTTTTATAATAATTTTCTTCTTGGTTATACCAATAATAATTGGTGGATTTGGAAATTGGCTTATTCCTTTGATAATCGGGGCTCCTGATATGGCCTTTCCTCGATTAAATAATTTAAGGTTTTGGCTGCTTGTACCAGCATTATTTTTGTTGTTAAGATCTTCTTTGGTAGAGAGGGGCGTTGGTACTGGGTGGACAGTATATCCACCTTTGTCTGGGAATGTTGGTCATTCCGGTGCTTCTGTAGATTTGGCTATCTTTTCTTTACACTTAGCTGGTGCTTCATCAATTTTGGGGGCTATTAATTTTATTTCTACTGTAGGAAATATACGATCTCCAGGTTTAGTTGCTGAGCGAATTCCTTTATTTGTATGGGCTGTGACTGTAACAGCTGTTTTACTGGTTGCTGCTTTGCCTGTTTTGGCTGGTGCTATTACAATGCTCCTTACTGATCGCAATCTGAATACTTCTTTTTTCGACCCTACTGGGGGAGGTGATCCTATTTTGTATATGCATTTGTTTTGATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anodonta beringiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Vinarski, M. & Cordeiro, J.

Reviewer/s
Böhm, M. & Collen, B.

Contributor/s

Justification
Anodonta beringiana has been assessed as Least Concern as despite serious questions about the current status of the western North American Anodonta species, it is probably the most stable of western Anodonta due to its northern distribution with little human disturbance across its wide range. Where found, this species is often very abundant and appears to be stable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Despite serious questions with the current status of the western North American Anodonta species, Anodonta beringiana is probably the most stable of western Anodonta because of its northern distribution with little human disturbance in its wide range. When found this species is often very abundant and appears to be secure.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: This species prefers lakes, ponds or slow-moving streams with sand and gravel substrate and a depth of around 1 m (Hart and Fuller, 1974; D.G. Smith, pers. comm., 2004; Nedeau et al., 2005). it requires abundant dissolved oxygen and water relatively free of silt (including glacial till), which can smother mussels (Hart and Fuller, 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Populations appear to be abundant and stable where found, so that this species has been given a Nature Serve status of G4 (Least concern) (NatureServe 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Short term trends are unknown, however, notable declines in freshwater mussel populations in North America over the last 30 years are reason for concern (Williams et al., 1993; Williams and Neves, 2003). Although taxonomy of western Anodonta is currently in flux, the Yukon floater is probably the most stable of western Anodonta because of its northern distribution with little human disturbance in its range (Nedeau et al., 2005). When found this species is often very abundant, providing a stable source of food for otter and muskrat (Nedeau et al., 2005).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
It is unlikely that there are any major threats impacting the global population of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Low

Comments: Although taxonomy of western Anodonta is currently in flux, the Yukon floater is probably the most stable of western Anodonta because of its northern distribution with little human disturbance in its range (Nedeau et al., 2005). When found this species is often very abundant, providing a stable source of food for otter and muskrat (Nedeau et al., 2005).

Concerns include habitat loss/change, natural predation by birds and mammals (especially otter, mink and muskrat) and radical changes in host fish populations. Physical threats include smothering by fine sediments and exposure to air or extremes in temperature and levels of dissolved oxygen (Hart and Fuller 1974), all of which may be caused by natural events or human pollution and habitat disturbance. Damming changes current and substrate characteristics making conditions less favorable for mussel reproduction and anchoring, often removing or disturbing fishes, thereby eliminating glochidial hosts (Hart and Fuller 1974). Erosion caused by deforestation, poor agricultural processes or destruction of riparian zones has led to increased silt loads in many streams and has been linked to the decline of freshwater mussels (Williams et al. 1993). Introduced mollusks (e.g. the Asian clam, Corbicula fluminea, and the zebra mussel, Dreissena polymorpha, currently pose no immediate threat; however, these invasives continue to spread rapidly and are predicted to occur in the entire contiguous United States and southern Canada within 10-20 years (Williams and Neves 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place. This species has a Nature Serve status of G4 (Least concern) (NatureServe 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Baseline life history information needed. Research needed on the effects of human impacts and other threats to survival. Species' status is reliant on host fish populations; further research needed to determine all species of host fish utilized.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: No current federal regulations on the harvest of this species.

Needs: Management of this species is complicated because impacts to A. beringiana populations may not be immediately detectable due to its long lifespan. Management actions for this species should be included in management plans of host fish species. Impacts to stream and lake environments from development and resource extraction, and commercial and subsistence harvest will effect host fish populations and A. beringiana. Increase public awareness of freshwater mussels and their roles in ecosystems. Educate public to identify and report any suspected invasive mussel species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Recently, Zanatta et al. (2007) supported the monophyly of both Pyganodon and Utterbackia using mutation coding of allozyme data, but also resolved the Eurasian Anodonta cygnea to Pyganodon, Utterbackia, and North American Anodonta; indicating futher phylogenetic analysis of the Anodontinae is required including both North American and Eurasian species. In a phylogenetic analysis of western North American Anodonta using topotypic material as was available, Chong et al. (2008) found three deeply divided lineages: one clade including Anodonta oregonensis and Anodonta kennerlyi, one clade including Anodonta californiensis and Anodonta nuttalliana, and one clade including Anodonta beringiana. Chong et al. (2008) further found that A. beringiana is more closely allied with the Asian Anodonta woodiana than either of the other two western North American clades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!