Overview

Brief Summary

There are very few wild flat oysters around anymore. They have become rare due to disease and competition with the Pacific oyster. The oyster shells on the beach are usually remnants from very old animals, dead already for many years. The shell has a rather regular shape, in contrast to the Pacific oyster which can have all kinds of sharp protrusions. The flat oyster is edible. For some people it is only a slimy bunch of salt but, according to oyster-lovers, it is the most delicious thing ever.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Native oysters are gregarious animals, and start their lives as males. They mature sexually as males between eight and ten months old. From then on, oysters will change sex regularly, depending on the water temperature. If the temperature reaches 16°C, they become females every three or four years. If the temperature reaches 20°C, they will change to females each year. They only revert to being males during the cooler intervening periods. Oysters may live for as long as 15 years but the usual lifespan is thought to be around six years. Eggs are stored and fertilised in the gill cavity of the female and remain there for a week before becoming free-swimming larvae and being released. The sperm is passed through the gills as part of the normal feeding process. The oyster larvae join the plankton in the open sea until, after 10 or 20 days, they find a surface to attach themselves. Adult oysters feed by filtration, sieving out the plankton using their gills. The towns of Colchester in Essex and Whitstable in Kent have become famous for their Oyster Festivals. Oysters have been an important food source since prehistory, and during the Roman occupation, British oysters were exported in large quantities back to Italy. One claim for eating them is that they act as an aphrodisiac, although there is no scientific proof for this argument.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The native oyster is a bivalve mollusc, which means 'two shells', and is rough, scaly and yellowish-grey in colour. Each valve differs in shape and size; the left one (the one used by the oyster to attach itself to a surface) is concave, while the right one is flat and fits snugly inside the left. The right valve has concentric rings of a bluish colour, and the whole animal is roughly pear-shaped. Inside the shell, the colours range from blue to grey and include the opalescent 'mother of pearl'. Mother of pearl is secreted by the oyster around any foreign body that gets trapped between the shells, for example, a piece of sand or grit. In time, this builds up and forms a pearl.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Ostrea edulis is a bivalve mollusc that has an oval or pear-shaped shell with a rough, scaly surface. The two halves (valves) of the shell are different shapes. The left valve is concave and fixed to the substratum, the right being flat and sitting inside the left. The shell is off-white, yellowish or cream in colour with light brown or bluish concentric bands on the right valve. Ostrea edulis grows up to 110 mm long, rarely larger. The inner surfaces are pearly, white or bluish-grey, often with darker blue areas.Also commonly known as the flat oyster and European oyster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Oysters are found widely around the western European coastline as far north as Spitsbergen, and south to Morocco and the Mediterranean. They can turn up all around the British coast with the best areas being the Thames Estuary, the west coast of Scotland, the Solent, the estuary of the River Fal, and Loch Foyle. They are also cultivated in other parts of the world such as North America, Japan and Australasia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Belgian Exclusive Economic Zone, British Isles, De Panne, Dutch Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Grevelingen, Gulf of Maine, Irish Exclusive economic Zone, Mediterranean Sea, Monastir Bay, North Adriatic, North Coast of Tunisia, North East Atlantic, North West Atlantic, Norwegian Exclusive Economic Zone, Oostende, Swedish Exclusive Economic Zone, Tunis Gulf, Ukrainian Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wadden Sea, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America, Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 123 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0 - 226.5
  Temperature range (°C): 8.393 - 11.855
  Nitrate (umol/L): 2.055 - 10.807
  Salinity (PPS): 32.945 - 35.334
  Oxygen (ml/l): 5.996 - 6.579
  Phosphate (umol/l): 0.399 - 0.640
  Silicate (umol/l): 2.489 - 7.273

Graphical representation

Depth range (m): 0 - 226.5

Temperature range (°C): 8.393 - 11.855

Nitrate (umol/L): 2.055 - 10.807

Salinity (PPS): 32.945 - 35.334

Oxygen (ml/l): 5.996 - 6.579

Phosphate (umol/l): 0.399 - 0.640

Silicate (umol/l): 2.489 - 7.273
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Ostrea edulis is associated with highly productive estuarine and shallow coastal water habitats on firm bottoms of mud, rocks, muddy sand, muddy gravel with shells and hard silt. In exploited areas, suitable habitat is/has been created in the form of 'cultch' - broken shells and other hard substrata.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oysters need a firm bedrock or an artificial equivalent along coastlines on which to fasten themselves, in water rich in plankton no deeper than 20 metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / endozoite
Althornia crouchii lives within shell of Ostrea edulis

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ostrea edulis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGGGACGATTTGATAGAGCTTTTTGAAAATTTTTTCCGTGTCCAGTCTTACTTTATGGTAAGCGTCTGGATTTAATATCTACAAACCATTTAGACATTGGTAGTTTATACATAGTTTTTGGTTTTTGATCTGTTTTGGCTGGTACTAGACTTAGATCTTTAATTCGTTGAAGGTTATTTAATCCTGGATCTAAATTTTTAGATCCTGTATGTTATAATGCTGTGGTCACAATACATGCCTTAGTAATGATTTTCTTTTTTGTAATGCCAGTTATAATTGGTGGATTTGGCAATTGGCTAGTTCCGTTAATACTTCAAGTACCTGATATGCAGTTTCCTCGAATGAATGCTTTCAGGTTCTGAGTGTTACCAGTATCTTTATATTTTATGGTAGTTTCTGCATTTGTTGAAAATGGAGTTGGGACTGGCTGAACTGTCTACCCTCCTTTATCAACTTTTTCATATCATGGAATGTGCATGGATTTGGCAATTTTAAGATTACACTTAGCTGGGATTAGTTCAATTTTTAGTTCAATTAACTTTATAGTTACAATTACGAATATACGATCGGTGGATGGGCACTTATTAGCGTTGTTCCCTTGATCTATTAAAGTAACATCATTTTTACTGTTAACAACACTTCCAGTCTTGGCTGGAGGGTTGACAATATTACTTACCGATCGTCATTTTAACACATCTTTCTTTGACCCTGTAGGTGGTGGGGATCCTGTGTTATTTCAACATCTGTTCTGATTTTTCCTGGATTTGGTATATCTCTCACGTTTTATGTTTTTGGTCTACAAAAAAAAACTGCTTATGGAAATATGGGTATGTTCTATGCCATGTTTAAATATTGGGTTTTTAGGTTTCATTGTATGAGGTCATCACATGTTCGTCGCTGGCATGGATGTGGATACTCGTGCTTACTTTAGAGCTGCAACTGTGATTATTGCCGTTCCTACGGGTATTAAAGTTTTTGCTTGATTAGCTACAATAATAGGATCAAAAGTTTCTACAGAAGCACCTATGCTATGAAAACTAGGGTTTATTGCCCTTTTCACGATTGGTGGTCTTACTGGGTTAATTTTATCTAGTGCTTCAGTAGATGTGACTTTGCACGATACTTATTTTGTGACAGGCCACTTCCACTATGTTCTCTCTATAGGGGCTGTGTTTACTATTTTAGCTGGATTTACTCATTGATCTCCGTTGTTCTCACGAGTTATAATGCATCGTCAAAAGATGAAGAGACATTTTATTGCTATATTCTTAGGTGTAAATGTAGCTTTTCTACCTCATCACTTTCTAGGTTTAGCAGGTATGCCTCGTCGAGTTGTTGATTACCCTGATCAGTTTTGATTTTGAAATAAAGTTTCGACATTTGGGTCTCATTTAAGAACTGCATCACTCCTGCTGTTTGTATTTCTTGTATGAGAGGCATTTATATCACACCGACCTGTGGTTAGTGTTCGAAATAGGTCAAGGTCTCCTGAATGATCTGTAGCTGTAAATCTTCCAAAGCATGCAGCGTTGGAAAGAGCAAAGATGTCAGGCGGTTCTATCTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ostrea edulis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not protected. Listed as a priority species under the UK Biodiversity Action Plan.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Once a plentiful species around the UK coastline, the native oyster was the victim of serious overharvesting during the late 19th century, as they were a staple food of the poor and working classes. In the 15th century, fourpence would buy eight gallons of oysters, but by the beginning of the 20th century, they had become the expensive luxury they are today. This overfishing was probably a consequence of the expanding townships following the Industrial Revolution. Today the principal threat to the wild native oyster comes from disease and two introduced species, the American oyster drill shellfish Urosalpinx cinerea, and the slipper limpet Crepidula fornicata. The disease, Bonamiosis, is spread by a parasitic protozoan Bonamia ostreae. The oyster drill was brought to the UK by accident with imported American oysters and feeds on the young shellfish. The slipper limpet forms dense beds, competing with the oyster for spaces and food resources. It also produces a material known as 'mussel mud', a substance that covers potential oyster beds and makes it difficult for young oysters to establish themselves on a firm surface.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The oyster industry in the UK is a lucrative one, but is now dominated by the introduced Japanese or Pacific oyster Crassostrea giga. However, native oysters are farmed and potential sites are sometimes prepared by dumping broken shells, an aggregate known as 'cultch', which encourages young oysters, called 'spat', to form new beds. The native oyster is listed as a priority species in the UK Biodiversity Action Plan. The shell fishing industry in the UK is carefully regulated, and there is also a closed season on harvesting from 14 May to the 4 August during the critical spawning period, although this does not cover farmed oysters. The principal aims of the UK Action Plan for the native oyster are to maintain the current range of the oyster around the UK coastline and, where possible, increase the population and the number of viable oyster beds. In order to improve the species' chances, a number of laws and directives have been introduced in recent years. In 1987, a ban was imposed preventing the use of TBT-based anti-fouling paints on all vessels less than 25 metres in length. The ban was introduced for these smaller vessels as they are more likely to come into the shallower coastal waters than the larger sea-going ships. Shellfish farmers have welcomed the banning of the use of this paint, which is believed to affect the reproduction rates of oysters. There is also a European Directive governing the spread of diseases prevalent among bivalves. The shellfish industry is being encouraged to conduct more environmental impact assessments in areas thought suitable for re-introduction or, in some cases, on former sites that have become derelict.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ostrea edulis

'Belons' from Cancale, Brittany

Ostrea edulis is a species of oyster native to Europe and commonly known as the European flat oyster, Colchester native oyster, mud oyster, or edible oyster (despite this latter name it is not the only oyster that is edible by humans). When mature O. edulis adults range from 3.8 to 11 centimetres (1.5 to 4.3 in) across.[3] The species naturally ranges along the western and southern coasts of Europe from Norway to Morocco and including most of the British Isles and the Mediterranean coast.[4] Naturally viable populations have appeared in eastern North America from Maine to Rhode Island subsequent to artificial introduction in the 1940s and 1950s.[4]

Ostrea edulis is now also being maricultured in the states of California, Maine, and Washington in the United States. The species once dominated European oyster production but disease, pollution, and overfishing sharply reduced the harvest.[4] Today Pacific oysters, Crassostrea gigas, account for more than 75 percent of Europe’s oyster production.

Worldwide O. edulis harvest in tonnes, 1950-2003

U.S. oyster growers farm O. edulis in small quantities on both coasts. They are prized for their unique tannic seawater flavor, sometimes described as dry and metallic, and are more expensive than other American oysters.[4] The flavor is considered excellent for eating raw on the half shell.[5][6] In France the species has an AOC classification - only oysters harvested from the Bélon River in Brittany can be called Bélon oysters (French: Huîtres de Bélon.[citation needed]

Ostrea edulis; a) labial palpi b) gills c) mantle d) junction of the two folds of the mantle e) large adductor muscle f) the shell

See also

References

  1. ^ Linnaeus, Carl (1758). Systema Naturae (in Latin) (10 ed.). Uppsala: Linnaeus. 
  2. ^ "ITIS Standard Report Page: Ostrea edulis". Retrieved 2008-08-06. 
  3. ^ Jackson, Angus (2008-07-14). "Basic information for Ostrea edulis (Native oyster)". Plymouth: Marine Biological Association of the United Kingdom. Retrieved 2008-08-07. 
  4. ^ a b c d "FAO Fisheries & Aquaculture Ostrea edulis". FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS. Retrieved 2008-08-06. 
  5. ^ "Ostrea Edulis & Others - TIME". Time magazine. 1964-07-31. Retrieved 2008-08-07. 
  6. ^ "Kelly Galway Oysters". Retrieved 2008-08-07. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!