Overview

Comprehensive Description

Summary

"Lopha cristagalli, commonly called the Cockscomb oyster, is widespread in the Indo-west Pacific oceans."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"Shell thick, strongly ribbed and broadly rounded in shape; margins with characteristic deep zig-zag pattern; outer shell surface variable in colour, but usually dark to light purple or brown, covered with many small and rounded protruberances; inner shell surface porcelain-like and greyish-white in colour; upper and lower valves interlock with each other through teeth-like processes."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Usual diameter: 10cm. Maximum diameter: 20.5cm.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

General Habitat

Marine: cemented to stones or corals in shallow sub-tidal coral reefs at depths of 5-30m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 6 - 65.8
  Temperature range (°C): 23.278 - 24.820
  Nitrate (umol/L): 0.149 - 2.380
  Salinity (PPS): 35.284 - 35.493
  Oxygen (ml/l): 4.230 - 4.703
  Phosphate (umol/l): 0.104 - 0.308
  Silicate (umol/l): 1.297 - 1.453

Graphical representation

Depth range (m): 6 - 65.8

Temperature range (°C): 23.278 - 24.820

Nitrate (umol/L): 0.149 - 2.380

Salinity (PPS): 35.284 - 35.493

Oxygen (ml/l): 4.230 - 4.703

Phosphate (umol/l): 0.104 - 0.308

Silicate (umol/l): 1.297 - 1.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Stationary suspension feeders.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lopha cristagalli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTAGTTCCGCTAATGCTTCAAGTCCCTGACATGCAATTTCCTCGTATAAATGCTTTTAGATTTTGAGTATTGCCTGTTTCTCTTTATTTTATAGTGGTTTCTGCCTTTGTTGAAAATGGGGTAGGTACGGGCTGAACTGTATACCCTCCTTTGTCCACTTTCTCGTATCAT---GGGATGTGTATGGATTTGGCTATTTTAAGACTTCATCTAGCTGGGATTAGGTCGATTTTCAGATCTATTAACTTTATGGTGACAATTACTAACATGCGGTCAGTGGAC------GGTCATCTGTTGGCTTTATTCCCATGGTCAATTAAAGTAACTTCTTTCTTGTTGCTCACTACACTCCCAGTACTGGCAGGTGGTTTGACTATGTTGCTAACAGACCGTCACTTTAACACCTCTTTCTTCGATCCAGTAGGAGGTGGTGACCCGGTGCTATTTCAGCATTTATTCTGGTTCTTTGGGCATCCTGAGGTGTATGTTCTAATTTTACCTGGATTTGGTATGATTTCCCATGTTTTATGTTTCTGATCTAGAAAAAAGACTGCCTATGGTAATATGGGGATGTTTTACGCAATGCTAAACATTGGATTTTTAGGTTTTATTGTGTGGGGCCATCATATGTTTGTTGCTGGTATAGACGTTGACACACGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lopha cristagalli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Not evaluated by the IUCN Redlist.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

Listed in CITES: No. Listed in Wildlife (Protection) Act: No
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Cockscomb oyster

The cockscomb oyster, Lopha cristagalli, is a species of marine bivalve molluscs in the family Ostreidae.

Description[edit]

The cockscomb oyster has a shell reaching a maximum diameter of about 20.5 cm, commonly 10 cm. It has a variable coloration, dark to light purple, and it is a thick, strongly ribbed, and slightly inequivalve shell. The shell inside is porcelaneous, usually purplish-brown or whitish in colour. The margins of the valves have a characteristic zig-zag pattern. The surfaces of both valves have many small, low, and rounded protuberances. These molluscs are stationary epifaunal suspension feeders, as they feed filtering sea water to extract the nutrients.

Distribution and habitat[edit]

This species is widespread in the Indo-West Pacific, from East Africa, including Madagascar, Mauritius, the Red Sea, Seychelles, and the Persian Gulf, to Micronesia; north to Japan and south to Papua New Guinea and Indonesia. It lives on coral reefs in shallow subtidal waters at depths of 5 to 30 m.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!