Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species is found throughout the Tennessee, Cumberland, and Ohio River basins, the upper Mississippi River, and the St. Lawrence River system from Lake Huron to Lake Ontario including their tributaries (Parmalee and Bogan, 1998). Due to much confusion surrounding the use of Unio nebulosus within the Villosa iris complex, Parmalee and Bogan (1998) chose to list all the described taxa from the Ohio, Tennessee, and Cumberland River systems as synonyms of Villosa iris and restrict the use of Villosa nebulosa to the species occurring in the headwaters of the Mobile Bay Basin. In Canada, it was historically known from the Ausable, Bayfield, Detroit, Grant, Maitland, Moira, Niagara, Salmon, Saugeen, Sydenham, Thames and Trent Rivers, as well as Lakes Huron, Ontario, Erie, and St. Clair; but it appears to have been lost from the lower Great Lakes and connecting channels, except for the Lake St. Clair Delta, but it is still extant in most rivers (COSEWIC, 2006). Recently this species has been confirmed to be likely extirpated from the main channel of the Detroit River between Lake St. Clair and Lake Erie, Michigan/Ontario; due to zebra mussel invasion (Schloesser et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The rainbow mussel is found in the Ohio, Tennessee and upper Mississippi river systems. In the Great Lakes it is found in drainages of Lakes Michigan, Huron, Ontario and Erie. The southern limit of this species is difficult to define because of taxonomic uncertainties of species and subspecies in the south.

Found in Michigan's lower peninsula, Villosa iris occurs in the Lake Michigan tributaries from the Muskegon south to the St. Joseph River on the west side of the state. On the east side of the state it is also found in the Saginaw River drainages and Lake Erie drainages.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The rainbow mussel is found in the Ohio, Tennessee and upper Mississippi river systems. In the Great Lakes it is found in drainages of Lakes Michigan, Huron, Ontario and Erie. The southern limit of this species is difficult to define because of taxonomic uncertainties of species and subspecies in the south.

Found in Michigan's lower peninsula, V. iris occurs in the Lake Michigan tributaries from the Muskegon south to the St. Joseph River on the west side of the state. On the east side of the state it is also found in the Saginaw River drainages and Lake Erie drainages.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The rainbow is up to 7.6 cm (3 inches) long , and is elongate and oblong in shape. The shell is usually fairly thin. Males are compressed and females are inflated. The   Umbos are low, even, or raised slightly above the hinge line. The beak sculpture has four to six double-looped ridges, the first two or three concentric. The umbos also have tubercles at the posterior end.

The periostracum (outer shell layer) is smooth except for growth lines. The shell is yellow to yellow-green with heavy broken green rays. The rays are more numerous on the posterior two-thirds of the shell.

On the inner shell, the   pseudocardinal teeth, which are small, erect, and divergent and sharp-pointed. The two lateral teeth are straight, short and fine. The right valve has one erect, columnar pseudocardinal tooth. Anterior to this tooth sometimes is a smaller nacreous swelling. The one lateral tooth has short and thin.

The beak cavity is shallow. The nacre is bluish-white, more blue posteriorly, and beak cavity is cream-colored. The posterior end is iridescent.

In Michigan, the rainbow can be confused with the Venustaconcha ellipsiformis and the Villosa fabalis. The rays on the ellipse are fine, wavy and generally unbroken. The rainbow also has a longer hinge line and has finer teeth. The rayed bean is smaller and generally darker in color and more inflated.

Range length: 7.6 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The rainbow is up to 7.6 cm (3 inches) long , and is elongate and oblong in shape. The shell is usually fairly thin. Males are compressed and females are inflated. The   anterior end is uniformly rounded, the posterior end sharply rounded in females to bluntly pointed in males. The dorsal margin is straight and the ventral margin is straight to gently curved.

Umbos are low, even, or raised slightly above the hinge line. The beak sculpture has four to six double-looped ridges, the first two or three concentric. The umbos also have tubercles at the posterior end.

The periostracum (outer shell layer) is smooth except for growth lines. The shell is yellow to yellow-green with heavy broken green rays. The rays are more numerous on the posterior two-thirds of the shell.

On the inner shell, the   left valve has two   pseudocardinal teeth, which are small, erect, and divergent and sharp-pointed. The two lateral teeth are straight, short and fine. The right valve has one erect, columnar pseudocardinal tooth. Anterior to this tooth sometimes is a smaller nacreous swelling. The one lateral tooth has short and thin.

The beak cavity is shallow. The nacre is bluish-white, more blue posteriorly, and beak cavity is cream-colored. The posterior end is iridescent.

In Michigan, the rainbow can be confused with the ellipse and the rayed bean. The rays on the ellipse are fine, wavy and generally unbroken. The rainbow also has a longer hinge line and has finer teeth. The rayed bean is smaller and generally darker in color and more inflated.

Range length: 7.6 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species lives in riffles along the edges of emerging vegetation, such as Justicia beds, in gravel and sand in moderate to strong current. It becomes most numerous in clean, well-oxygenated stretches at depths of less than three feet (Parmalee and Bogan, 1998). It is most abundant in small to medium-sized rivers but can also be found in inland lakes (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The rainbow is found in cool, clear, upper reaches of small to medium streams. Substrates it inhabits include sandy mud, coarse sand, or gravel, in areas near faster currents.

In the Huron River it was found on sand and gravel shoals that had a good current. This species is also found in Lake Erie.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The rainbow is found in cool, clear, upper reaches of small to medium streams. Substrates it inhabits include sandy mud, coarse sand, or gravel, in areas near faster currents.

In the Huron River it was found on sand and gravel shoals that had a good current. This species is also found in Lake Erie.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, Unionidae are filter feeders. The mussels use cilia to pump water into the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

In lab trials, Villosa_iris glochidia metamorphosed on the Lepomis cyanellus, Micropterus dolomieu, Micropterus salmoides, Micropterus notius, Micropterus punctulatus, Luxilus chrysocephalus, Erimystax dissimilis, Gambusia affinis, Etheostoma blennioides, Etheostoma caeruleum, Etheostoma camurum, Percina maculata, and Perca flavescens.

Ecosystem Impact: parasite

Species Used as Host:

  • green sunfish, Lepomis_cyanellus 
  • smallmouth bass, Micropterus_dolomieu 
  • largemouth bass, Micropterus_salmoides 
  • Suwanee bass, Micropterus_notius 
  • spotted bass, Micropterus_punctulatus 
  • striped shiner, Luxilus_chrysocephalus 
  • streamline chub, Erimystax_dissimilis 
  • mosquitofish, Gambusia_affinis 
  • greenside darter, Etheostoma_blennioides 
  • rainbow darter, Etheostoma_caeruleum 
  • bluebreast darter, Etheostoma_camurum 
  • blackside darter, Percina_maculata 
  • yellow perch, Perca_flavescens 

  • Neves, R., L. Weaver, A. Zale. 1985. An evaluation of host fish suitability for glochidia of Villosa vanuxemi and V. nebulosa (Pelecypoda: Unionidae). America Midland Naturalist, 113: 13-19.
  • Zale, A., R. Neves. 1982. Fish hosts of four species of lampsiline mussels (Mollusca: Unionidae) in Big Moccasin Creek, Virginia. Canadian Journal of Zoology, 60: 2535-2542.
  • Watters, G., S. O'Dee. 1997. Potential hosts for Villosa iris (Lea, 1829). Triannual unionid report, 12: 7. Accessed October 01, 2005 at http://ellipse.inhs.uiuc.edu/FMCS/TUR/TUR12.html#p9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Unionidae in general are preyed upon by Ondatra zibethicus, Procyon lotor, Mustela vison, Lontra canadensis, and some birds. Juveniles are probably also fed upon by Aplodinotus grunniens, Archosargus probatocephalus, Acipenser fulvescens, Minytrema melanops, Moxostoma, and Lepomis gibbosus.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic Trematoda feeding on gill and mantle tissue. Parasitic Chironomidae larvae may destroy up to half the mussel gill.

Known Predators:

  • muskrat, Ondatra_zibethicus 
  • mink, Mustela_vison 
  • raccoon Procyon_lotor 
  • otter, Lontra_canadensis 
  • turtles, Testudines 
  • hellbenders, Cryptobranchus 
  • freshwater drum, Aplodinotus_grunniens 
  • sheepshead, Archosargus_probatocephalus 
  • lake sturgeon, Acipenser_fulvescens 
  • shortnosed sturgeon, Acipenser_brevirostrum 
  • spotted suckers, Minytrema_melanops 
  • common red-horse, Moxostoma 
  • catfish, Siluriformes 
  • pumpkinseed, Lepomis_gibbosus 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

In lab trials, Villosa iris glochidia metamorphosed on the green sunfish, smallmouth bass, largemouth bass, Suwanee bass, spotted bass, striped shiner, streamline chub, mosquitofish, greenside darter, rainbow darter, bluebreast darter, blackside darter, and yellow perch.

Ecosystem Impact: parasite

Species Used as Host:

  • Neves, R., L. Weaver, A. Zale. 1985. An evaluation of host fish suitability for glochidia of Villosa vanuxemi and V. nebulosa (Pelecypoda: Unionidae). America Midland Naturalist, 113: 13-19.
  • Zale, A., R. Neves. 1982. Fish hosts of four species of lampsiline mussels (Mollusca: Unionidae) in Big Moccasin Creek, Virginia. Canadian Journal of Zoology, 60: 2535-2542.
  • Watters, G., S. O'Dee. 1997. Potential hosts for Villosa iris (Lea, 1829). Triannual unionid report, 12: 7. Accessed October 01, 2005 at http://ellipse.inhs.uiuc.edu/FMCS/TUR/TUR12.html#p9.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: In Wisconsin, this species is extremely rare (Mathiak, 1979). In Illinois, it is restricted to the north fork Vermilion River where it is sporadic (Cummings and Mayer, 1997). It was recently collected in the Middle Fork North Branch Vermillion River and Jordan Creek in Illinois and Indiana (Szafoni et al., 2000); recently in the Fox River basin (weathered subfossil) and in Wisconsin (live) in the Mukwonago River (possibly the only remaining population in the entire Upper Mississippi River basin) (Schanzle et al., 2004). Indiana distribution: Wabash mainstem (historical) and tributaries (current) (Fisher, 2006), Tippecanoe (Cummings and Berlocher, 1990), East Fork White (Harmon, 1992). In Ohio, it is widespread across the state but absent from the unglaciated southeast (Watters, 1992; 1995; Lyons et al., 2007; Grabarciewicz, 2008; Watters et al., 2009). In North Carolina, it is reported from the Hiwassee, Little Tennessee, and historically from the French Broad Rivers (Bogan, 2002) in Cherokee, Clay, Jackson, Macon, and Swain Cos. (LeGrand et al., 2006). It was reported from the upper South Fork Holston (Stansbery and Clench, 1978) and recently in Copper Creek and Upper Clinch river in Virginia (Fraley and Ahlstedt, 2000; Jones et al., 2001; Hanlon et al., 2009). Jones and Neves (2007) summarize distribution in the upper North Fork Holston River (Smyth and Bland Cos., Virginia) as rkm 135.8 to 209.2. In Tennessee, it occurs throughout the upper Tennessee River drainage including the Powell, Clinch, Holston, Watauga, French Broad, Nolichucky, Little Pigeon, Little, Obed, Little Tennessee, Hiwassee, and Sequatchie Rivers. In the lower Tennessee River, it may be found in numerous tributaries including the Elk, Buffalo, and Duck Rivers. In the Cumberland River system, it is found sporadically in the Big South Fork Cumberland, Obey, Caney Fork, Collins, and Stones Rivers, but rarely in the mainstem of the Cumberland River (Parmalee and Bogan, 1998). In Alabama, it is restricted to the Tennessee River system (Mirarchi, 2004) in the Paint Rock River (Ahlstedt, 1996) and other tributaries (Williams et al., 2008). In Kentucky, it is occasional to sporadic in the lower Cumberland River and eastward (Cicerello and Schuster, 2003), South Fork Kentucky (Evans, 2008) and Green (Gordon, 1991). It was recently collected from 6 of 38 sites surveyed (only found alive at a single site) in the Tonawanda Creek basin (Niagara River drainage) in western New York (Marangelo and Strayer, 2000). It was found in Little Mahoning Creek watershed, Pennsylvania (Chapman and Smith, 2008). This species is also known from the Clinton River drainage in Michigan (Trdan and Hoeh, 1993; Strayer, 1980) and southern upper peninsula (Goodrich and Van der Schalie, 1939) in Lakes Michigan and St. Clair basins (Badra and Goforth, 2003). Specimens from the Black River (St. Clair drainage), Michigan, were relocated to the Detroit River in 1992 (Trdan and Hoeh, 1993). It was recently found in the Little River, Oklahoma (Vaughn and Taylor, 1999; Vaughn, 2000); where it was known historically (Branson, 1984). It was collected in the 1990s in the Poteau (Vaughn and Spooner, 2004) and Mountain Fork (Spooner and Vaughn, 2007) Rivers, Arkansas/Oklahoma. In Canada, this species was once widely distributed and relatively common in southern Ontario, but is now extremely rare in most systems, but significant populations can still be found in the Sydenham (Metcalfe-Smith et al., 2003), Maitland River (Lake Huron drainage), Moira River (Lake Ontario drainage), and the delta area of Lake St. Clair (Metcalfe-Smith and Cudmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: A small population, estimated at 7200 individuals, occupies the Canadian waters of the Lake St. Clair delta but is declining at a rate of 7% per year. Other Canadian populations (Ausable, Grand, Saugeen, sydenham Rivers) are very small with only 20 specimens collected from 148 sites in these rivers over the past 10 years. The population in the East Sydenham River consists of 18,900 individuals, but appears to be declining. The Upper Thames River population is estimated at 40,000 mussels, but may also be declining. The Maitland River supports the largest and healthiest Canadian populatin with CPUE 10 to 100 times higher than any other Canadian water body (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. Mantle flaps in the lampsilines are modified to attract potential fish hosts. The rainbow mussel has a mantle flap resembling an aquatic insect. If the mussel recognizes a specific fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Glochidial hosts include Betta splendens (Siamese fighting fish), Erimystax dissimilis (streamline chub), Etheostoma blennioides (greenside darter), Etheostoma caeruleum (rainbow darter), Etheostoma camurum (bluebreast darter), Lepomis cyanellus (green sunfish), Luxilus chrysocephalus (striped shiner), Micropterus dolomieu (smallmouth bass), Micropterus salmoides (largemouth bass), and Perca flavescens (yellow perch) (Watters and O'Dee, 1997). New host fish confirmation from Watters et al. (2005): Cottus bairdi (mottled sculpin) and Micropterus dolomieu (smallmouth bass). One host, Micropterus salmoides (largemouth bass), is capable of acquired resistance to glochidial infection following repeated infection attempts in the laboratory (Dodd et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Villosa iris is a long-term brooder. In the Huron River in Michigan, it was gravid from mid-August to the following mid-July. It probably spawns from late July to mid-August in Michigan.

Breeding interval: The rainbow mussel breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably late July to mid-August.

Range gestation period: 11 (high) months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Villosa iris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTATATTTGTTGTTAGCACTATGGTCTGGTTTGATTGGTTTGGCTCTGAGTCTTTTGATTCGTGCTGAGTTAGGGCAGCCTGGTAGGTTGTTGGGGGAT---GATCAGCTATATAATGTGATTGTAACAGCACATGCTTTTATAATAATTTTCTTTTTGGTTATACCTATAATGATTGGTGGTTTTGGTAATTGACTTATTCCTCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGGTTGAATAACTTAAGTTTTTGGTTATTGGTACCAGCTCTATTTTTATTACTGAGTTCTTCTTTGGTGGAGAGTGGTGTTGGGACTGGATGAACGGTATATCCTCCGTTGTCTGGAAATGTGGCTCATTCTGGTGCTTCGGTGGATTTAGCGATTTTTTCTTTACATTTGGCTGGTGCTTCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTTGGAAATATGCGGTCTCCTGGATTGGTTGCTGAACGGATTCCGTTGTTTGTGTGGGCTGTTACAGTAACAGCCGTTTTGTTGGTTGCGTCATTGCCTGTTTTGGCTGGTGCTATTACAATGCTACTTACTGATCGAAATATTAATACATCTTTTTTTGATCCTGTTGGGGGAGGGGATCCTATTTTATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Villosa iris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: This species is found throughout the Tennessee, Cumberland, and Ohio River basins, the upper Mississippi River, and the St. Lawrence River system from Lake Huron to Lake Ontario including their tributaries and is considered stable in much of its range but is declining significantly in Canada.

Intrinsic Vulnerability: Unknown

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: This species lives in riffles along the edges of emerging vegetation, such as Justicia beds, in gravel and sand in moderate to strong current. It becomes most numerous in clean, well-oxygenated stretches at depths of less than three feet (Parmalee and Bogan, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Villosa_iris is listed as Endangered in Illinois and Wisconsin. In Michigan and North Carolina it is considered Special Concern.

IUCN Red List of Threatened Species: no special status

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Villosa iris is listed as Endangered in Illinois and Wisconsin. In Michigan and North Carolina it is considered Special Concern.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: In Canada, this species was once widely distributed and relatively common in southern Ontario, but is now extremely rare in most systems, but significant populations can still be found in the Maitland River (Lake Huron drainage), Moira River (Lake Ontario drainage), and the delta area of Lake St. Clair (this population threatened by zebra mussels) (Metcalfe-Smith and Cudmore-Vokey, 2004). In Canada, it was historically known from the Ausable, Bayfield, Detroit, Grant, Maitland, Moira, Niagara, Salmon, Saugeen, Sydenham, Thames and Trent Rivers, as well as Lakes Huron, Ontario, Erie, and St. Clair; but it appears to have been lost from the lower Great Lakes and connecting channels, except for the Lake St. Clair Delta, but it is still extant in most rivers although it is likely extirpated from the Niagara and Detroit Rivers and most previously inhabited areas of Lake Erie and Lake St. Clair (COSEWIC, 2006). It was recently documented in the Fox River basin in Illinois by only weathered subfossil material and in Wisconsin by live specimens in the Mukwonago River (possibly the only remaining population in the entire Upper Mississippi River basin) (Schanzle et al., 2004).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: In Canada, it was historically known from the Ausable, Bayfield, Detroit, Grant, Maitland, Moira, Niagara, Salmon, Saugeen, Sydenham, Thames and Trent Rivers, as well as Lakes Huron, Ontario, Erie, and St. Clair; but it appears to have been lost from the lower Great Lakes and connecting channels, except for the Lake St. Clair Delta, but it is still extant in most rivers (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: Medium

Comments: The greatest threats occur in the Great Lakes portion of the range. This species has been lost from the lower Great Lakes and connecting channels largely due to impacts of the zebra mussel. Heavy loadings of sediment, nutrients and toxic substances from urban and agricultural sources have degratded mussel habitat throughout southern Ontario. The species is particularly sensitive to copper and ammonia (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Many (13-40) occurrences appropriately protected and managed

Comments: In Canada, land ownership along the reaches of the Sydenham, Thames, Ausable, Maitland, Grand and Saugeen Rivers is mainly private and in agricultural use. Only two small properties in the Sydenham River watershed (7 ha Shetland Conservation Area and 20 ha Mosa Township Forest) ar epublicly owned and somewhat protected. There are 21 natural areas (6200 ha) in the Thames River watershed and most of these are in upper reaches where the mussel occurs. Four indian Reserves occupy 6700 ha of land along 45 km of the river downstream of London but the species has not been found there. Less than 0.5% of land in the Maitland River watershed is owned by the Ausable Bayfield Conservation Authority and Maitland Valley Conservation Authority (total 3580 ha). Less than 3% of th eGrant River watershed is publicly owned and there are 11 conservation areas (one with the species). The Trent River is part of the Trent-Severn Waterway, one of seven national historic canals that are managed and protected by Parks Canada. Occupied habitats in Canadian portions of Lake St. Clair delta fall within the territory of the Walpole Island First Nation but the mussel is more common in the poorer protected U.S. portion of the delta (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: This species was deisignated as endangered in Canada in April 2006 and a status report prepared (COSEWIC, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Villosa iris

Villosa iris, common name the Rainbow mussel, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

Reproduction

All Unionidae are known to use the gills, fins, or skin of a host fish for nutrients during the larval glochidia stage. Female Villosa iris attract host fish by imitating a crayfish. Elongate papillae on the mantle margin resemble antennae, legs, and eyes. They also mimic crayfish behavior, moving the papillae independently like legs, and use "tail tucking" motions. [1]

Distribution

This species is widely distributed throughout the St. Lawrence, upper Mississippi, Ohio, Tennessee, and Cumberland River Basins. [2]

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Part of a complex formed by differing shell shapes and apparently different behaviors. Revision of this species group requires analysis of shell, antomical, and biochemical characters and must encompass all species of the genus VILLOSA. characters and must encompass all species of the genus Villosa. Due to much confusion surrounding the use of Unio nebulosus within the Villosa iris complex, Parmalee and Bogan (1998) chose to list all the described taxa from the Ohio, Tennessee, and Cumberland River systems as synonyms of Villosa iris and restrict the use of Villosa nebulosa to the species occurring in the headwaters of the Mobile Bay Basin.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!