Overview

Distribution

Geographic Range

The eastern pond mussel is found from the James River of Virginia north to the St. Lawrence drainages in Canada, west to Lake Erie, Ohio and Michigan.

In Michigan L. nasuta is found in the lower peninsula in drainages on the eastern side of the state. Generally, this is a pond and lake species.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) This species ranges from Lake Ontario and Lake Eries in Canada and Minnesota south and east to the Altantic drainages in North Carolina. Although widespread, it is declining in many places particularly Canadian Great Lakes (Johnson, 1970). Recently this species has been confirmed to be likely extirpated from the main channel of the Detroit River between Lake St. Clair and Lake Erie, Michigan/Ontario; due to zebra mussel invasion (Schloesser et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The eastern pondmussel is up to 10 cm (4 inches) long , and is elongate in shape, usually over twice as long as high. The shell is usually fairly thin and compressed, and this species has a distinct posterior ridge. The   anterior end is rounded, the posterior end pointed. The dorsal margin is straight and the ventral margin is straight to curved as it .

Umbos are low, being raised only slightly above the hinge line. The beak sculpture has double-looped ridges.

The periostracum (outer shell layer) is smooth, except for growth lines and tan to dark green, sometimes with fine green rays. Older specimens tend to be more brown or black.

On the inner shell, the   left valve has one to two   pseudocardinal teeth, which are triangular and delicate. The two lateral teeth are straight and long. The right valve has one triangular pseudocardinal tooth The one lateral is also straight and long.

The beak cavity is shallow to moderately deep. Although the nacre is white, occasionally it is has a pink or salmon tint and is iridescent at the posterior end.

In Michigan, this species can be confused with the black sandshell. The black sandshell is more cylindrical, not as pointed posteriorly, and is generally larger and thicker.

Range length: 10 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes shaped differently

  • Nedeau, E., M. McCollough, B. Swartz. 2000. The freshwater mussels of Maine. Augusta, Maine: Maine Department of Inland Fisheries and Wildlife.
  • Cordeiro, J. 2003. "Family Unionidae: Genus Ligumia" (On-line). Freshwater Mussels of the New York Metropolitan Region and New Jersey. A guide to their identification, biology, and conservation. Accessed September 05, 2006 at http://cbc.amnh.org/mussel/ligumiagenustext.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The eastern pondmussel is usually found in lakes, ponds, or quiet waters of streams. Substrates it inhabits are variable. In the Huron River this species was found on sandy bottoms of quiet pools or in sandy areas of beach pools.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species inhabits protected areas of coastal lakes and ponds, in slackwater areas of rivers, slow moving streams, and in canals in a wide range of substrates (Nedeau et al., 2000). In Canada, it occurs in sheltered areas of lakes, in slack-water areas of rivers and in canals, where it prefers substrates of fine sand and mud at depths ranging from 0.3 to 4.5 m (COSEWIC, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

While freshwater mussels require a host fish for metamorphosis, the host for the eastern pondmussel is unknown.

Ecosystem Impact: parasite

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 - 300

Comments: Recently this species has been confirmed to be likely extirpated from the main channel of the Detroit River between Lake St. Clair and Lake Erie, Michigan/Ontario; due to zebra mussel invasion (Schloesser et al., 2006), though documented historically in the Clinton River (Strayer, 1980). In Rhode Island, it is only found within the Pawcatuck River basin (Raithel and Hartenstein, 2006). In Massachusetts, this species is uncommon in natural "great" ponds and lowland streams of most coastal drainage systems and in the Connecticut River (Smith, 2000). In Connecticut, it is known from the Connecticut River watershed and historically in the south central coast watershed (Nedeau and Victoria, 2003; J. Cordeiro, pers. comm., 2006). It does not occur in Maine (Nedeau et al., 2000). In Maryland, it is known from the Upper Potomac, Washington Metro, Choptank, and Pocomoke River drainages (Bogan and Proch, 1995). Bogan and Alderman (2004) list South Carolina distribution as historically from the Savannah River basin and from the Pee Dee, and Cooper-Santee River basins with an extant population in the Savannah River basin in Georgia documented. It is found in low numbers in two locations (Great Pee Dee River) in Pee Dee River drainage in South Carolina (Catena Group, 2006). In North Carolina, it is known from the Pee Dee, Cape Fear, Pamlico, Roanoke, and Chowan (Alderman and Alderman, 2009) River basins (Bogan, 2002) in Anson, Bertie, Brunswick, Chowan, Gates, Hertford, Nash (extirpated), Pitt (extirpated), Richmond, and Washington Cos. (LeGrand et al., 2006). In Ohio, it has entered Lake Erie and the Cuyahoga River (Watters, 1995) and Bass Islands of Lake Erie and much of Lake Erie proper with Muskingum River records probably erroneous (Watters et al., 2009). In Canada, this species is uncommon and declining and only occurs in Ontario where it is threatened severely by zebra mussels (Metcalfe-Smith and Cudmore-Vokey, 2004). It has been lost from nearly all its former range in Canada, but still occurs in the delta area of Lake St. Clair and a recent population in Lyn Creek (tributary of upper St. Lawrence River) near the outlet of Lake Ontario (COSEWIC, 2007). Historical Ontario distribution included Lake Ontario, Lake Erie, Lake St. Clair and their basins (Clarke, 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Comments: In the Pee Dee River basin in South Carolina, this species was only found at two locations (Great Pee Dee River, Little Pee Dee River) in very low numbers (Catena Group, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. Mantle flaps in the lampsilines are modified to attract potential fish hosts. How the eastern pondmussel attracts and/or recognizes its fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Ligumia nasuta is a long-term brooder. In the Huron River in Michigan, it was gravid from early August to late June. It probably spawns in July in Michigan.

Breeding interval: The eastern pondmussel breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably July.

Range gestation period: 11 (high) months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is a long-term brooder with fertilization in late summer and glochidial release the following spring. Host fish have not yet been determined. Gravid females were found to display marginal papillae to attract fish hosts for their parasitic larvae. The papillae move rapidly and synchronously attracting fish which attack displaying females causing them to release glochidia onto the fish. Display frequency slows in low light and stops in dark and high turbidity also stops displays (Corey et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ligumia nasuta

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTATATTTGTTATTGGCACTGTGATCTGGTTTGATTGGTTTGGCTCTAAGTCTTTTAATTCGGGCTGAGTTGGGACAACCTGGTAGATTATTAGGGGAT---GATCAGTTATATAATGTGATTGTGACAGCGCATGCTTTCATAATAATTTTCTTTTTGGTTATACCAATGATGATTGGTGGTTTTGGTAATTGGCTTATTCCGCTTATGATTGGAGCTCCTGATATGGCTTTTCCTCGGTTAAACAACTTAAGGTTTTGGTTGTTAGTACCAGCTTTGTTTTTGCTATTGAGTTCTTCTTTGGTGGAGAGTGGTGTTGGGACTGGGTGGACTGTTTATCCCCCATTGTCTGGGAATGTGGCTCATTCTGGGGCCTCGGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCTTCTATTTTGGGAGCTATTAATTTTATTTCTACTGTTGGGAATATGCGATCTCCTGGGTTGGTTGCTGAACGAATTCCGTTGTTTGTGTGAGCTGTTACAGTAACAGCAGTTTTACTGGTTGCAGCGTTACCTGTTTTGGCTGGTGCTATTACAATGTTACTTACTGATCGTAACATTAATACTTCTTTTTTTGATCCCGTTGGAGGAGGGGACCCTATTTTGTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ligumia nasuta

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LR/nt
Lower Risk/near threatened

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ligumia nasuta is listed as Endangered in Delaware and Ohio, Threatened in New Jersey and Special Concern in Massachusetts. It is also a Species of Concern in Rhode Island. The IUCN Red List considers this species Lower Risk, near Threatened on the IUCN Red List.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: lower risk - near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: This is a widespread species that once was locally abundant from the Great Lakes to much of the Atlantic Slope, but has experienced decline in most areas (significantly so in the Canadian Great Lakes to New York, and New England).

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Narrow to moderate.

Comments: This species inhabits protected areas of coastal lakes and ponds, in slackwater areas of rivers, slow moving streams, and in canals in a wide range of substrates (Nedeau et al., 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: In Canada, over 93% of historical records (occurs in Ontario only) are threatened by zebra mussels (COSEWIC, 2007; Metcalfe-Smith and Cudmore-Vokey, 2004). In Canada, this species is uncommon and declining and only occurs in Ontario where it is threatened severely by zebra mussels (Metcalfe-Smith and Cudmore-Vokey, 2004). It has been lost from nearly all its former range in Canada, but still occurs in the delta area of Lake St. Clair and a recent population in Lyn Creek (tributary of upper St. Lawrence River) near the outlet of Lake Ontario (COSEWIC, 2007). This species has experienced some declines, particularly in New England (Nedeau et al., 2000), northern and western New York (Strayer and Jirka, 1997), and Canada as well as some Atlantic slope states such as South Carolina (Catena Group, 2006). Recently this species has been confirmed to be likely extirpated from the main channel of the Detroit River between Lake St. Clair and Lake Erie, Michigan/Ontario; due to zebra mussel invasion (Schloesser et al., 2006).

Global Long Term Trend: Decline of 30-50%

Comments: This species has experienced some declines, particularly in New England (Nedeau et al., 2000) and Canada as well as some Atlantic slope states. It was historically known from Ohio in the Black River (Lyons et al., 2007). Nearly all of its former range in Canada has been lost as this species was once one of the most common species of freshwater mussel in the lower Great Lakes(COSEWIC, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: The greatest threat to Canadian populations is the invasive zebra mussel as 90% of historical records are from zebra mussel infested waters (Metcalfe-Smith and Cudmore-Vokey, 2004). Zebra mussels constitute the most significant threat to the continued existence of this species in Canada (COSEWIC, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: The largest known Canada population occupies the territorial waters of the Walpole Island First Nation in the delta area of Lake St. Clair; which are protected from urban development and certain recreational uses (COSEWIC, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: This species was deisignated as endangered in Canada in April 2007 and a status report prepared (COSEWIC, 2007).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ligumia nasuta

Ligumia nasuta (eastern pondmussel) is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States. Like many Unionoid mussels, female eastern pondmussels display a lure to attract their fish hosts (see video). Underwater video of a female L. nasuta displaying

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!