Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) The creeper is distributed very widely throughout the Ohio and Mississippi Rivers and Great Lakes systems, northern Atlantic Coast drainages, and parts of Canadian Interior Basin as far west as Texas and Saskatchewan (Burch, 1975; Parmalee and Bogan, 1998) and historically into Kansas and Nebraska (Hoke, 2005). Presumably, it occurred throughout the Tennessee River system historically. Colorado reports are in error/unconfirmed (Wu, 1989; Cordeiro, 1999; Clarke et al., 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The creeper is widespread throughout most of the eastern half of the United States through the southern edge of Canada, but absent in Florida, Georgia, and South Carolina. Drainages where it is found include the Interior basin from central Texas to Lake Winnipeg, Canada, and the Canadian Interior basin in the Nelson River from western Ontario to Saskatchewan. In the upper Atlantic drainage it is found in the upper Savannah river system of South Carolina. This species is also found in the St. Lawrence river system and Nova Scotia.

In Michigan this species is widespread throughout river systems in both the upper and lower peninsulas.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The creeper is up to 10.2 cm (4 inches) long. Headwater specimens are generally smaller than those found in larger creeks. The shell is elliptical or oval and ranges from being thin to fairly thick in older individuals. The   anterior end is broadly rounded and the posterior end is bluntly pointed or truncated. The dorsal margin is rounded and the ventral margin is straight to slightly curved.

Umbos are low and raised only slightly above the hinge line. The beak sculpture has three to five v-shaped ridges.

The periostracum (outer shell layer) is green with rays, and brown to black in older individuals.

On the inner shell, the   left valve has a   pseudocardinal tooth which is mainly a thickening of the hinge line. The tooth is located under the beak. The right valve has a similar thickening of the hinge line, with the tooth anterior to the beak. Lateral teeth are absent.

The beak cavity is shallow. The nacre is cream colored or salmon in the center and bluish-white on the outer margin.

In Michigan, this species can be confused with the cylindrical papershell or giant floater. The cylindrical papershell in general is more cylindrical. The creeper has a beak sculpture that is more coarse. In general, the creeper generally has a more truncated posterior end than the giant floater. The hinge on the creeper is also generally thicker and has a more concentric beak sculpture.

Range length: 10.2 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Oesch, R. 1984. Missouri naiades, a guide to the mussels of Missouri. Jefferson City, Missouri: Missouri Department of Conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species is a habitat generalist, with a wide distribution. It is usually found in streams and rivers in a range of flow conditions (rarely in high-gradient streams of mountainous regions) but can tolerate lakes and ponds, particularly in outlets.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Strophitus undulatus is found in a wide range of habitats, from headwaters to pools to larger streams. It is probably more scarce in lower reaches of rivers, and is generally absent from land-locked lakes.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: rivers and streams

  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Cummings, K., C. Mayer. 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed August 25, 2005 at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 37 - 37
  Temperature range (°C): 27.753 - 27.753
  Nitrate (umol/L): 1.048 - 1.048
  Salinity (PPS): 34.301 - 34.301
  Oxygen (ml/l): 4.272 - 4.272
  Phosphate (umol/l): 0.324 - 0.324
  Silicate (umol/l): 4.145 - 4.145
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

Strophitus undulatus glochidia are unique in that they may metamorphose without the use of a fish host. However, the glochidia have also metamorphosed on several species of fish in lab trials. No natural infestations on fish have been recorded. Species of fish that the S. undulatus glochidia have metamorphosed on include: channel catfish, black bullhead, yellow bullhead, burbot, plains killifish, bluegill, pumpkinseed, black crappie, white crappie, green sunfish, rock bass, smallmouth bass, largemouth bass, common shiner, common stoneroller, river chub, creek chub, blacknose dace, longnose dace, northern redbelly dace, bluntnose minnow, fathead minnow, spotfin shiner, sand shiner, spottail shiner, central mudminnow, banded darter, fantail darter, rainbow darter, Iowa darter, johnny darter, slenderhead darter, logperch, blackside darter, yellow perch, walleye and brook stickleback.

Creeper glochidia have been found on: channel catfish, black bullhead, yellow bullhead, burbot, plains killifish, bluegill, pumpkinseed, black crappie, white crappie, green sunfish, rock bass, smallmouth bass, largemouth bass, common shiner, common stoneroller, river chub, creek chub, blacknose dace, longnose dace, northern redbelly dace, bluntnose minnow, fathead minnow, spotfin shiner, sand shiner, spottail shiner, central mudminnow, banded darter, fantail darter, rainbow darter, Iowa darter, johnny darter, slenderhead darter, logperch, blackside darter, yellow perch, walleye and brook stickleback.

Ecosystem Impact: parasite

Species Used as Host:

Commensal/Parasitic Species:

  • Hove, M., R. Engelking, M. Peteler, E. M. Peterson, A. R. Kapuscinski, L. A. Sovell and E.R. Evers. 1997. Suitable fish hosts for glochidia of four freshwater mussels. Conservation and Management of Freshwater Mussels II. Proceedings of a UMRCC Symposium, 16-18 October 1995, St. Louis, Missouri: 21-25.
  • Hillegass, K., M. Hove. 1997. Suitable fish hosts for glochidia of three freshwater mussels: strange floater, ellipse, and snuffbox. Triannual Unionid Report, 13: 25. Accessed October 04, 2005 at http://ellipse.inhs.uiuc.edu/FMCS/TUR/TUR13.html#p16.
  • Watters, G., S. O'Dee, S. Chordas. 1998. New Potential Hosts. Triannual Unionid Report, 15: 27-29. Accessed October 04, 2005 at http://ellipse.inhs.uiuc.edu/FMCS/TUR/TUR15.html#p21.
  • van Snik Gray, E., W. Lellis, J. Cole, C. Johnson. 1999. Hosts of Pyganodon cataracta (eastern floater) and Strophitus undulatus (squawfoot) from the Upper Susquehanna River basin, Pennsylvania. Triannual Unionid Report, 18: 6. Accessed October 04, 2005 at http://ellipse.inhs.uiuc.edu/FMCS/TUR/TUR18.html#p5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Unionids in general are preyed on by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: In Alabama, it is only in Bear Creek (Colbert Co.) (Mirarchi et al., 2004; Williams et al., 2008). Tennessee (statewide): upper Clinch, Powell, Watauga, Little, Elk, Big S Fork Cumberland, Stones, Harpeth to Hatchie and W (Parmalee and Bogan, 1998). In Kentucky, Green River E (Cicerello and Schuster, 2003). In Mississippi: Mississippi River S, Yazoo, and Tennessee basins (Jones et al., 2005). It is in the White (rare) (Gordon, 1982; Christian, 1995), lower Arkansas (Gordon, 1985), Ouachita (Posey et al., 1996; Posey, 1997), and Poteau (Vaughn and Spooner, 2004), Arkansas. It is in all Illinois drainages (Cummings and Mayer, 1997; Schanzle and Cummings, 1991; Sietman et al., 2001; Schanzle et al., 2004; Tiemann et al., 2005). In Indiana: E. Fork White (Harmon, 1992), Muscatatuck (Harmon, 1989); Tippecanoe (Cummings and Berlocher, 1990). It is throughout Ohio (Watters, 1995; Lyons et al., 2007; Grabarciewicz, 2008; Hoggarth et al., 2007; Watters et al., 2009). In Louisiana, it is in the N (Cypress Creek, Bayou D'Arbonne, Tensas, Little Corney Bayou, Dugdemona, Sabine, Bayou Pierre) (Vidrine, 1993). In West Virginia: Upper Ohio (Zeto et al., 1987), Upper Potomac (Clayton et al., 2001; Taylor, 1985). In Maryland, it is in the Upper Potomac, Washington Metro, Chester, Choptank drainages (Bogan and Proch, 1995); lower Susquehanna (Ashton, 2009). In Maine, it is uncommon in most basins (absent from Knox, Lincoln, York Cos.) (Nedeau et al., 2000). In Rhode Island, it is in the middle to S (Raithel and Hartenstein, 2006). In Vermont, it is widely distributed; rarely common (Fichtel and Smith, 1995). Connecticut: Connecticut, Housatonic, Thames drainages (Nedeau and Victoria, 2003; J. Cordeiro, pers. obs., 2006). Massachusetts: most drainages (uncommon exc. Connecticut tribs.) (Smith, 2000). In the Delaware basin, it is in all drainages (Middle Delaware- Mongaup- Broadhead, Upper Delaware, E Branch Delaware); New York to Pennsylvania (Strayer and Ralley, 1991). In Minnesota, it is abundant statewide (Sietman, 2003); Red and Lake of the Woods; not Lake Superior (Graf, 1997; Cvancara, 1970). In South Carolina, it is widespead in the Savannah, Cooper-Santee, and Pee Dee basins (Bogan and Alderman, 2004); Great Pee Dee (Catena Group, 2006); Santee (Alderman, 2006). In South Dakota, it is in the Minnesota, Big Sioux (Skadsen and Perkins, 2000), Lake Kampeska, Vermillion (Backlund, 2000), and James (Perkins and Backlund, 2003). In North Carolina, it is widespread in Atlantic slope (Broad, Pee Dee, Cape Fear, Neuse, Pamlico, Roanoke); French Broad (Tennessee basin) (Bogan, 2002; LeGrand et al., 2006- 36 Cos.). Oklahoma: Illinois, Kiamichi, Neosho, Poteau, Clear Boggy Rivers (Branson, 1983); Mountain Fork (Spooner and Vaughn, 2007), Little and Red Rivers (Vaughn and Taylor, 1999; Vaughn, 2000). In Texas, from Guadalupe drainage N and E (Howells et al., 1996) and Cypress Bayou NE (Mather and Bergmann, 1994). In Wisconsin, it is widespread and abundant (Mathiak, 1997). In Kansas, it is in the Neosho, Verdigris, Spring, and Marais des Cygnes basins; historical in Wakarusa (Tiemann, 2006), Ninnescah (AR), Smoky Hill to lower Republican (KS), and S Fork Big Nemaha (MO) (Couch, 1997). In the Little Blue, weathered in Kansas/Nebraska (Hoke, 2004); common in Kansas part of Big Blue (most weathered); and in Big Hemana (E) (Hoke, 2005); also Platte (Hall, Buffalo Cos.) and Niobrara (Sioux Co.) (Freeman and Perkins, 1992; 1997). It is in the Clinton drainage, Michigan (Strayer, 1980; Goodrich and Van der Schalie, 1939) and Lakes Michigan, Huron, St. Clair drainages (Badra and Goforth, 2003). In Canada, it is widespread/abundant in Ontario; sensitive in Manitoba (Assiniboine drainage- Watson, 2000; Pip, 2006) and Quebec, at risk in Nova Scotia (Cumberland, Cape Breton Cos.) (Athearn and Clarke, 1962; Clarke and Rick, 1964); and information lacking on Saskatchewan and New Brunswick (Shediac River- Athearn, 1961) (Metcalfe-Smith and Cudmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: This species was recently collected in the Opequon River (Potomac watershed) in West Virginia (Vila et al., 2003). Smith and Crabtree (2010) found this species at 8 of 32 sites (unknown how many with recruitment) along the entire length of Pennsylvania's French Creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. How the creeper recognizes its fish host is not known.

Glochidia respond to both touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The age of mussels can be determined by looking at annual rings on the shell. However, no demographic data on this species has been recorded.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The creeper is a long-term brooder, with eggs fertilized in the summer and glochidia released the following spring. Van Snik Gray et al. (2002) found glochidia released 26 April to 2 June in laboratory conditions mimicking Pennsylvania stream habitats. Laboratory studies by Ellis and Keim (1918) revealed plains killifish (Fundulus zebrinus) and green sunfish (Lepomis cyanellis) as glochidial hosts as well as creek chub (Semotilus atromaculatus) according to Baker (1928). Later studies by Hillegass and Hove (1997) found the following fish to be suitable hosts: black bullhead (Ameiurus melas), largemouth bass (Micropterus salmoides), green sunfish (Lepomis cyanellus), black bullhead (Ameirus natalis), and yellow perch (Perca flavescens). Previous studies by Hove (1995) and Hove et al. (1997) also revealed fathead minnow (Pimephales promelas), spotfin shiner (Cyprinella spiloptera), walleye (Stizostedion vitreum), and bluegill (Lepomis macrochirus) as glochidial hosts. Wicklow and Beisheim (1998) found the following fish to be suitable hosts: the longnose dace (Rhinichthys cataractae), fallfish (Semotilus corporalis), golden shiner (Notemigonus crysoleucas), and slimy sculpin (Cottus cognatus). They also found that the larvae of the northern two-lined salamander (Eurycea bislineata) was a suitable glochidial host. Watters et al. (1998a; 1998b; 1999) documented other hosts including fantail darter (Etheostoma flabellare), banded darter (Etheostoma zonale), sand shiner (Notropis lundibundus), bluntnose minnow (Pimephales notatus), and white crappie (Pomoxis annularis). Van Snik Gray et al. (1999; 2002) found 15 hosts (10 of which were previously unknown) bringing the total number to 29, second only to Pyganodon grandis at 32. New host species reported by Van Snik Gray et al. (1999; 2002) include: Acipenser oxyrhynchus- Atlantic sturgeon, Campostoma anomalum- central stoneroller, Luxilus cornutus- common shiner, Nocomis micropogon- river chub, Rhinichthys atratulus- blacknose dace, Oncorhynchus mykiss- rainbow trout, Salvelinus fontinalis- brook charr, Ambloplites rupestris- rock bass, Etheostoma olmstedi- tessellated darter, and Notophthalmus viridescens- red-spotted newt. Recent studies (include those mentioned above) are contrary to early reports (Lefevre and Curtis, 1911) that this species may metamorphose without a host. This species utilizes amphibians as well as fish for hosts. Cliff et al. (2001) futher documented central stoneroller (Campestoma anomalum), brook stickleback (Culaea inconstans), rainbow darter (Etheostoma caeruleum), Iowa darter (Etheostoma exile), Johnny darter (Etheostoma nigrum), channel catfish (Ictalurus punctatus), pumpkinseed (Lepomis gibbosus), burbot (Lota lota), smallmouth bass (Micropteris dolomieu), spottail shiner (Notropis hudsonius), logperch (Percina caprodes), blackside darter (Percina maculata), slenderhead darter (Percina phoxocephala), northern redbelly dace (Phoxinus eos), black crappie (Pomoxis nigromaculatus), blacknose dace (Rhinichthys atratulus), creek chub (Semotilus atromaculatus), and central mudminnow (Umbra limi). New host fish confirmation from Watters et al. (2005): rainbow darter (Etheostoma caeruleum), red-eared sunfish (Lepomis microlophus). Watters et al. (2006) include Ameirus nebulosus brown bullhead, Etheostoma zonale banded darter, and Percina caprodes logperch as hosts. Hove (1995) and Hove et al. (1997) list Cyprinella spiloptera spotfin shiner

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Increasing water temperatures stimulates male mussels to produce sperm and release it into the water column, where it is taken up by nearby females.

Mating System: polygynandrous (promiscuous)

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Strophitus undulatus is a long-term brooder. Gravid females were observed on the Huron River from late July to the end of May. Glochidia are likely released at the end of May.

Breeding interval: Creepers breed once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is probably early June to late July.

Range gestation period: 10 (high) months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • van der Schalie, H. 1938. The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40: 1-83.
  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Strophitus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATACTTATTATTGGCTTTGTGGTCTGGTTTGATTGGGTTAGCTTTGAGGCTTTTGATCCGGGCTGAGTTAGGTCAGCCAGGAAGGTTATTGGGGGAT---GATCAATTATATAATGTAATTGTTACGGCTCATGCTTTTATAATAATTTTTTTCTTGGTTATGCCTATGATAATTGGTGGATTTGGCAATTGGCTTATTCCTTTGATAATTGGCGCTCCGGATATGGCTTTTCCTCGGTTAAACAATTTAAGATTTTGGCTTCTTGTACCAGCATTGTTTTTGTTATTAAGATCTTCGTTGGTTGAGAGGGGTGTGGGTACTGGTTGAACAGTATATCCTCCTTTGTCAGGAAATATCGCTCATTCTGGGGCTTCGGTGGATTTAGCTATTTTTTCTTTGCATCTTGCTGGTGCTTCATCAATTTTGGGTGCTATTAATTTTATTTCTACTGTTGGAAATATGCGGTCTCCAGGCTTGGTTGCTGAGCGAATTCCTTTGTTTGTTTGGGCTGTTGCAGTTACAGCTGTGTTGTTGGTTGCTGCTCTTCCGGTTTTGGCTGGTGCTATTACAATACTACTTACTGATCGTAATTTAAACACTTCTTTTTTTGACCCTACAGGAGGAGGTGATCCAATTTTGTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Strophitus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: The species is extremely wide ranging being one of the few North American mussels to occur on both sides of the Appalachian Mountains. It is distributed throughout the Mississippi River and Great Lakes systems, northern Atlantic Coast drainages, and parts of Canadian Interior Basin. Presumably, it occurred throughout the Tennessee River system historically. In Alabama, it reaches its southern limit in a short reach of Bear Creek, Colbert Co., where it may not be viable, otherwise it is considered stable throughout its wide range.

Intrinsic Vulnerability: Not intrinsically vulnerable

Comments: Widespread, though not usually common; generalist.

Environmental Specificity: Broad. Generalist or community with all key requirements common.

Comments: Habitat generalist.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Strophitus undulatus is listed as threatened in Iowa and Special Concern in Massachusetts. It is also a Species of Concern in Rhode Island and South Carolina.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: This species is extremely rare or extirpated from the North Fork Holston River, Virginia (Jones and Neves, 2007).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: It is historically known from the Upper Clinch River, Virginia (Jones et al., 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: This species occurs in Muddy Creek (French Creek drainage) in the Erie NWR in Crawford Co., Pennsylvania (Mohler et al., 2006). Specimens from the Black River (St. Clair drainage), Michigan, were relocated to the Detroit River in 1992 (Trdan and Hoeh, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Strophitus undulatus

Strophitus undulatus is a species of mussel in the Unionidae, the river mussels. It is native to eastern Canada and the eastern United States. Its common names include creeper, squawfoot, sloughfoot, and strange floater.[1][2]

This mussel has a somewhat flattened, smooth, oval shell which is thin in young animals and becomes thicker with age. It is green, brown, or black in color with pink to orange nacre. It grows up to 10.2 centimeters long. The beak is ridged.[1][2]

This species lives in a variety of freshwater habitat types, including rivers, streams, ponds, and lakes. It tolerates still water and low to moderate flow gradients, but usually not high flow areas.[3] It lives in mud, sand, and gravel substrates.[1]

Like other freshwater mussels, this species releases larvae called glochidia, which must attach parasitically to a host organism, generally a fish, so they can develop into free-living juveniles. Some mussels release their glochidia inside a spongy, sticky mass called a conglutinate. The conglutinate sometimes resembles a prey item, such as a worm, which attracts the fish. When the fish bumps the conglutinate, it breaks apart and releases the glochidia, which attach to the fish. S. undulatus produces an interesting kind of conglutinate. It is whitish and rod-shaped, up to 7 millimeters long and contains around 12 glochidia. The glochidia of this species are larger than those of most other mussels, measuring up to almost 500 micrometers. The conglutinate moves by itself, making a pulsing motion. This may be caused by the swelling of the structure when it contacts the water. The motion helps to squeeze out the glochidia and it may help to attract fish hosts. Sometimes one of the glochidia will attach to a host while remaining attached to the conglutinate; in this case, the other glochidia in the structure may be dragged along with it and have an easier opportunity to parasitize the host.[4]

This mussel uses a wide variety of organisms as hosts, especially fish. It has been observed on black bullhead (Ameiurus melas), largemouth bass (Micropterus salmoides), green sunfish (Lepomis cyanellus), yellow perch (Perca flavescens), fathead minnow (Pimephales promelas), spotfin shiner (Cyprinella spiloptera), walleye (Stizostedion vitreum), bluegill (Lepomis macrochirus), longnose dace (Rhinichthys cataractae), fallfish (Semotilus corporalis), golden shiner (Notemigonus crysoleucas), slimy sculpin (Cottus cognatus), and many others. It can also use amphibians as hosts, such as the larva of the northern two-lined salamander (Eurycea bislineata), and red-spotted newt (Notophthalmus viridescens).[3] It has been noted to parasitize species not native to the ecosystem, as well as an anadromous species.[5] The glochidia of this mussel may very occasionally be able to develop without attaching to a host species.[6]

This common mussel has a wide range in North America, and its populations are stable in most areas.[3]

References[edit source | edit]

  1. ^ a b c Strophitus undulatus. Illinois Natural History Survey, Prairie Research Institute.
  2. ^ a b Strophitus undulatus. Iowa Department of Natural Resources.
  3. ^ a b c Strophitus undulatus. NatureServe.
  4. ^ Watters, G. T. (2002). The kinetic conglutinate of the creeper freshwater mussel, Strophitus undulatus (Say, 1817). Journal of Molluscan Studies 68 155-58.
  5. ^ Gray, E. V., et al. (2002). Host identification for Strophitus undulatus (Bivalvia: Unionidae), the creeper, in the Upper Susquehanna River Basin, Pennsylvania. American Midland Naturalist 147:1 153-61.
  6. ^ Anderson, T. Strophitus undulatus (creeper): A technical conservation assessment. USDA Forest Service, Rocky Mountain Region, Species Conservation Project. March 10, 2005.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The taxonomic status of Strophitus in western Gulf Coast drainages is unclear as Strecker (1931) reported S. subvexus from eastern Texas but Howells et al. (1996) considered all individuals in the state to be S. undulatus. Meanwhile, Vidrine (1993) suggested that Strophitus from western Louisiana (i.e., those in the Calcasieu and Sabine Rivers) represent an undescribed species similar to S. subvexus. Williams et al. (2008) confined S. subvexus to the Tombigbee and Black Warrior River drainages and S. connasaugensis to eastern drainages of the Mobile Basin, however individuals resembling S. subvexus can sometimes be found ineastern reaches of the Mobile basin and individuals resembling S. connasaugaensis can occasionally be found in the Black Warrior and Tombigbee River drainages.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!