Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (250-1000 square km (about 100-400 square miles)) The fuzzy pigtoe is endemic to and still extant in the Escambia, Pea, and Choctawhatchee rivers in Alabama and Florida, and the Yellow River in Alabama (Mirarchi et al., 2004; Williams et al., 2008; Gangloff and Hartfield, 2009). Due to recent status surveys the historical range of the fuzzy pigtoe has been expanded (Williams et al., 2000; Blalock-Herod et al., 2005). Within the Escambia River drainage, the fuzzy pigtoe has been found in the Escambia River, Escambia and Santa Rosa Counties, Florida; Conecuh River, Escambia, Covington, Crenshaw, and Pike Counties, Alabama; Murder, Sandy, and Burnt Corn Creeks, Conecuh County, Alabama; Sepulga River, Conecuh County, Alabama; Pigeon Creek, Covington County, Alabama; Patsaliga and Little Patsaliga Creeks, Crenshaw County, Alabama; and Mill Creek, Pike County, Alabama. Within the Yellow River drainage, the fuzzy pigtoe is known from the Yellow River, Covington County, Alabama. Within the Choctawhatchee River drainage, the fuzzy pigtoe was known from Choctawhatchee River, Washington, Walton, and Holmes Counties, Florida; Limestone Creek, Walton County, Florida; Wrights Creek, Holmes County, Florida; Holmes Creek, Washington County, Florida; Choctawhatchee River, Geneva and Dale Counties, Alabama; Little Choctawhatchee River, Dale and Houston Counties, Alabama; Panther Creek, Houston County, Alabama; West Fork Choctawhatchee River, Dale and Barbour Counties, Alabama; East Fork Choctawhatchee River, Henry County, Alabama; and Pea River, Geneva, Dale, and Coffee Counties, Alabama (Williams et al., 2000; Blalock-Herod et al., 2005) (see USFWS, 2003). Blalock-Herod et al. (2005) listed this species from 21 historical sites in the Choctawhatchee River drainage, relocated it at 6 and found it at 34 new sites scattered in the upper and lower portions of the river in Alabama and Florida.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 5.8 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Subtriangular outline, rounded ventral margin, obtusely angular posterior slope, satiny brown periostracum, bluish white nacre.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: It is found in medium-sized creeks and rivers, in sand and silty sand substrates with slow to moderate current (Williams and Butler, 1994; Williams et al., 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species inhabits moderate current rivers in small to medium -sized rivers, where it is found in silty-mud and silty-sand substrates.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Adults are essentially sessile. About the only voluntary movement they make is to burrow deeper into the substrate although some passive movement downstream may occur during high flows. Dispersal occurs while the glochidia are encysted on their host (probably a fish).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Presumably fine particulate organic matter, primarily detritus, and/or zooplankton, and/or phytoplankton (Fuller, 1974). Larvae (glochidia) of freshwater mussels generally are parasitic on fish and there may be a specificity among some species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 80

Comments: Recent mussel status surveys found that the populations of the fuzzy pigtoe (represented by live animals and shell material) have declined from: 31 historic sites to 18 currently active sites, 8 inactive, and 5 undetermined population status within the Escambia River drainage; 4 historic sites to 0 currently active sites within the Yellow River drainage; and 51 historic sites to 40 currently active sites, 7 inactive sites. In totality, the fuzzy pigtoe has declined from a total of 86 historic sites to its remaining distribution of 58 sites. It has been extirpated from approximately 22% of its historic range. Only 4 populations were represented by 10 - 20 individuals, but most supported only 1 or 2 individuals (Williams et al., 2000; Blalock-Herod et al., 2005). At least some of the extant populations may be capable of reproducing, as one specimen was found with eggs partially in swollen marsupia during July (Williams et al. in review). Low-level recruitment may be occurring; however, long-term viability of the fuzzy pigtoe is questionable (see USFWS, 2003). Blalock-Herod et al. (2005) listed this species from 21 historical sites in the Choctawhatchee River drainage, relocated it at 6 and found it at 34 new sites scattered in the upper and lower portions of the river in Alabama and Florida. Pilarczyk et al. (2006) recorded recent collections (in 2004) of this species following surveys of 24 sites at 11 sites including West Fork Choctawhatchee River, Eightmile Creek (just over the border in Florida), Patsaliga Creek, Pea River, Pea Creek, East Fork Choctawhatchee River, and Murder Creek compared to Murder Creek, Bottle Creek, West Fork Choctawhatchee River, Patsaliga Creek, Pigeon Creek, Jordan Creek, Little Patsaliga Creek, Flat River, Eightmile Creek (Florida), Pea River, Pea Creek, Judy Creek, and Hurricane Creek in surveys of the same sites in the 1990s. White et al. (2008) utilized specimens from Eightmile Creek in Walton Co., Florida for host suitability studies. Gangloff and Hartfield (2009) found it abundantly in 5 Pea River sites and 1 Choctawhatchee River sites, Alabama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Comments: Known Alabama populations seem to be small. Back in 1988, catch rates in exemplary Alabama sites were 25 per hour. A total of 30 subpopulations were known in 1996. Large lots can be found representing the Choctawhatchee system in Florida in museum collections dating to the 1930's. Recent surveys (e.g., Williams et al., 2000, Blalock et al., 1998) did not include abundance information. Pilarczyk et al. (2006) recorded recent collections (in 2004) of this species following surveys of 24 sites at 11 sites.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Probably tachytictic (short-term brooder), as are other, more northern, members of the genus. White et al. (2008) tested host suitability on 20 potential fish species and confirmed transformation only on Cyprinella venusta (blacktail shiner). Conglutinates were creamy or peach-colored and wide with a flattened appearance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema strodeanum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTGTGATCTGGTTTGATTGGGTTGGCTCTGAGTCTTTTGATCCGAGCTGAGTTGGGGCAACCTGGTAGGTTGTTGGGGGAT---GATCAATTATATAATGTGATTGTGACGGCACATGCTTTTATAATAATTTTTTTCTTGGTGATACCTATAATAATTGGAGGTTTTGGTAATTGGCTTATTCCTCTTATGATTGGGGCTCCAGATATGGCTTTTCCTCGATTAAATAATTTGAGGTTTTGGTTACTTGTACCTGCTTTGTTTTTATTGTTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGAACTGGTTGAACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGGGCTTCGGTGGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATCTCTACTGTGGGGAATATGCGGTCTCCTGGGGTGGTTGCTGAGCGAATTCCTTTGTTCGTATGGGCTGTGACAGTAACAGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCCATTACAATATTGCTTACTGATCGTAATATTAACACGTCTTTTTTTGATCCTGTTGGAGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema strodeanum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: This species is known from 65-85 sites (from about 90 historic) in three river drainages. However, populations appear to be declining and there is general deterioration of habitat and water quality in some portion of its range. Recently, however, the overall range has expanded slightly as populations were discovered in new drainages.

Intrinsic Vulnerability: Highly to moderately vulnerable.

Comments: Presumable sensitive to excessive siltation and habitat modifications; typical liabilities of filter-feeders (e.g., to excessive pollutants, eutrophication, etc.); reduction in host fish populations is a possibility.

Environmental Specificity: Unknown

Other Considerations: Many species of the genus are declining, particularly the narrow and regional endemics of the Gulf coast drainages east of the Mississippi. It was considered threatened in Florida (Williams and Butler, 1994), threatened in the Escambia and Yellow River systems (Williams et al., 2000), and a species of special concern throughout its range (Williams et al., 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1c+2c, B1+2bcd

Version
2.3

Year Assessed
2000
  • Needs updating

Assessor/s
Bogan, A.E. & Seddon, M.B. (from TNC, R.S. Butler)

Reviewer/s
Seddon, M.B. (Mollusc Red List Authority)

Contributor/s

Justification
A total of 30 subpopulations were known in 1996. At the Alabama site rates of find were 25 per hour in 1988. There is under 200 km length of available river for this species.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 10/10/2012
Lead Region:   Southeast Region (Region 4) 
Where Listed:


For most current information and documents related to the conservation status and management of Pleurobema strodeanum, see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Recent status surveys indicated that this species has experienced range reductions and occurs in low abundance within its limited range. In totality, the fuzzy pigtoe has declined from a total of 86 historic sites to its remaining distribution of 58 sites . It has been extirpated from approximately 22% of its historic range (see USFWS, 2003).

Global Long Term Trend: Decline of 30-50%

Comments: Although uncommon, it is still extant in all threee drainages where it was known historically in Alabama (Williams et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Siltation from poorly conducted agricultural and silvicultural activities, agricultural and silvicultural runoff; chicken farm litter nutrients; gravel/sand mining and oil/gas exploration; localized industrial (pulp mill in Escambia in Alabama near Florida border), municipal pollution; watershed development (bridge, highway construction, etc.). Silvicultural activities and chicken farms are expanding in southern Alabama. Twenty-five different impoumdments have been proposed for the Choctawhatchee River system alone (Blalock et al., 1998). Bank sloughing has impacted habitat in the Escambia mainstem in Florida. The stream and river habitats are vulnerable to habitat modification, sedimentation, and water quality degradation from a number of activities. Highway and reservoir construction, improper logging practices, agricultural runoff, housing developments, pipeline crossings, and livestock grazing often result in physical disturbance of stream substrates or the riparian zone, and/or changes in water quality, temperature, or flow. Sedimentation can cause direct mortality of mussels by deposition and suffocation (Ellis, 1936; Brim Box and Mossa, 1999) and can eliminate or reduce the recruitment of juvenile mussels (Negus, 1966; Brim Box and Mossa, 1999). Suspended sediment can also interfere with feeding activity of mussels (Dennis, 1984). Many of the confirmed extant populations of this species are in the vicinity of highway and unpaved road crossings due to ease of access for surveyors. Highway and bridge construction and widening could affect populations of these species unless appropriate precautions are implemented during construction to reduce erosion and sedimentation, and maintain water quality standards. The construction of reservoirs and the associated habitat changes (e.g., changes of sediments, flow, water temperature, dissolved oxygen) can directly impact mussel populations (Neves et al., 1997). Nutrients, usually phosphorus and nitrogen, may emanate from agricultural fields, residential lawns, livestock feedlots, poultry houses, and leaking septic tanks in levels that result in eutrophication and reduced oxygen levels in small streams. Other factors include (1) over-utilization for commercial, recreational, scientific, or educational purposes (note: species is not commercially valuable nor are the streams and rivers it inhabits subject to harvesting activities for commercial mussel species), (2) disease or predation (poorly known but may contribute to the further decline of these species due to their restricted distributions and low numbers associated with extant populations), (3) the inadequacy of existing regulatory mechanisms (note: less success in dealing with non-point source pollution impacts, particularly sediments, to small stream drainages), (4) catastrophic events (populations are generally small and geographically isolated), (5) host fish loss or decline (note host not known), (6) populations below effective population size to maintain long term viability (some populations below required population size to maintain long-term genetic viability), (7) invasive species (Asiatic clam, zebra mussel, black carp) (see USFWS, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Siltation, water pollution (agricultural run-off, residential), channel alteration (dredging, road/bridge construction), dam construction for flood control are threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Determine life history, reproductive biology, fecundity, viability of extant populations, microhabitat requirements, sensitivity to excessive sedimentation and pollutants; determine host fish, its requirements, and population status; develop propagation techniques.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: There is a possibility that at least one occurrence may border the Conecuh National Forest in Alabama.

Needs: Make it a candidate for federal listing; protect populations through acquisitions and easements by working with government agencies and conservation organizations; establish buffers and streamside management zones for all agricultural, silvicultural, mining, and developmental activities; maintain high water and benthic habitat quality; consider propagation and reintroduction of cultured stock, and consider federal listing if populations decline further. Conservation activities have been limited to working with private landowners in south Alabama and west Florida to encourage the use of Best Management Practices to reduce the effects of agriculture and silviculture. (see USFWS, 2003)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Conservation activities have been limited to working with landowners in west Alabama and south Florida to limit the effects of agricultural practices on populations. This species has probably been negatively affected greatest by poor land use practices resulting in habitat destruction and leading to decline and imperilment.

This species has been listed as a federal candidate species in the U.S. in 2004 (USFWS, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fuzzy pigtoe

The fuzzy pigtoe, scientific name Pleurobema strodeanum, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States. Its natural habitat is rivers. It is threatened by habitat loss.

Sources

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: There is some confusion regarding the taxonomy and distribution of Gulf slope Pleurobema (Brim Box and Williams, 2000). Heard (1979) listed Pleurobema pyriforme from the Apalachicola, Ochlockonee and Suwannee drainages, and included the Apalachicola River drainage in the distribution of Pleurobema strodeanum. Based upon recent genetic data (Kandl et al., 1997), Brim Box and Williams (2000) recognized only one species, P. pyriforme, from the Suwannee River drainage west to the Econfina Creek drainage, an independent coastal drainage located between the Choctawhatchee and Chipola rivers in west Florida. Therefore, the records of Pleurobema reclusum in Williams and Butler (1994) from the Suwannee and Ochlockonee rivers and Heard's (1979) records of P. strodeanum from the Apalachicola drainage are P. pyriforme. P. strodeanum occurs only in the Escambia, Choctawhatchee and Yellow rivers in west Florida and Alabama. The type locality is in the Escambia River, west Florida (Wright, 1898).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!