Overview

Distribution

Global Range: (<100 square km (less than about 40 square miles)) This species was historically found in the Conasauga River in Tennessee and Georgia, the Coosawatee, Oostanaula, Coosa, and Etowah Rivers in Georgia, and the Coosa River and following tributaries in Alabama: Big Wills, Terrapin, Big Canoe, Yellowleaf, Waxahatchee, Talledega, and Hatchet creeks (USFWS, 1999; 2003; 2009; 2010). In the Coosa River basin in Georgia, it is known historically from the Coosa, Etowah, Oostanaula, Conasauga, and Coosawattee River drainages (Williams and Hughes, 1998). Recently, fresh dead shells were collected in the upper Conasauga River above Dalton, Georgia (USFWS, 1999; 2003) and a single large specimen found alive also in the Conasauga River in Georgia (P. Johnson, TN Aquarium Research Institute, pers. comm.). The species has been extirpated from Alabama (Mirarchi et al., 2004; Mirarchi, 2004) where it was endemic to the Mobile basin; and nearly so in Tennessee (see Johnson et al., 2005) and Georgia (Williams et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AL, GA, TN)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Pleurobema aldrichianum Goodrich, 1931
Catalog Number: USNM 382459
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Dry
Collector(s): University of Alabama
Locality: Conasauga River, Near Conasauga, Tennessee, United States
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits stretches of a medium sized river with good current and a sand/gravel substrate A substrate composed of coarse sand and gravel in stretches of rivers with good current provides the most suitable habitat (Parmalee and Bogan 1998).

Pleurobema hanleyianum inhabits shoals of large creeks and small to large rivers. Pleurobema hanleyianum is believed to be a short-term brooder, gravid in spring and summer. Its glochidial hosts are unknown, but some Pleurobema species use members of the Cyprinidae (Haag and Warren 2003, Williams et al. 2008).

Direct life-history data are not available for this species. Freshwater mussels are highly variable in their longevity from species to species (e.g. Haag and Rypel 2011). Studies have shown longevity of Pleurobema species to range from 19 to 45 years (from populations of P. coccineum, P. collina and P. decisum: average of 31 years; Haag and Rypel 2011). In a study of fecundity and maturity in a number of freshwater mussels, age at maturity range from less than one year in Lampsilis ornata to up to nine years in Quadrula asperata; unfortunately there was no estimate for representatives of the genus Pleurobema (Haag and Staton 2003). Conservatively assuming a first age of maturity of 2-5 years, generation length (estimated as the average age of a parent in the population) is estimated as around 11-27 years, with three generations spanning approximately 33-81 years.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: This species inhabits stretches of a medium sized river with good current and a sand/gravel substrate A substrate composed of coarse sand and gravel in stretches of rivers with good current provides the most suitable habitat (Parmalee and Bogan, 1998). It is found in shallow runs and riffles with strong to moderate current and coarse sand-gravel-cobble bottom (USFWS, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Recent survey efforts have been extensive since 1990 when the USFWS initated a status survey in the Mobile River Basin. The species was, at the time, presumed extinct, but recent collections yielded a few fresh dead shells from localized portions of the Upper Conasauga River in Murray and Whitfield Counties, Georgia (Williams and Hughes, 1998; Johnson and Evans, 2000; Evans, 2001; USFWS, 2010). This species has been recently reported as a relict shell from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Polk Co., Tennessee (Johnson et al., 2005). Williams and Hughes (1998) cite potential records for Pleurobema perovatum in the Conasauga River drainage in Georgia, but both Paul Johnson and Paul Hartfiled believe that Georgia records for Pleurobema perovatum actually represent another Pleurobema (believed to be Pleurobema hanleyianum) (see USFWS, 2010). Gangloff (2003) surveyed all known historical sites for the species in Coosa River tributaries in Alabama without relocating the species. Similarly, McGregor and Garner (2004) surveyed the Coosa River dam tailraces without locating it either.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

1 - 1000 individuals

Comments: Currently this species is only known from a few recently dead shells (USFWS, 2003) and a recently discovered population represented by a single live individual indicating populations are likely no longer viable or extremely small (Johnson and Evans, 2000; USFWS, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

The glochidial host is not known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema hanleyianum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTATGATCTGGTTTGATTGGGTTGGCTCTGAGTCTTTTAATTCGAGCTGAGTTAGGGCAACCTGGTAGGTTGTTGGGAGAT---GATCAATTATATAATGTGATTGTGACAGCGCACGCTTTTATAATGATTTTTTTCTTGGTGATACCTATGATGATTGGGGGTTTTGGAAATTGGCTTATTCCTCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATCTGAGGTTTTGGTTACTTGTGCCTGCTCTCTTTTTGTTGTTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGGACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGAGCTTCAGTGGATTTAGCTATTTTTTCTTTACATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCCACTGTGGGGAATATGCGATCTCCTGGGTTGGTTGCTGAGCGAATTCCCTTATTCGTATGGGCTGTGACAGTAACARCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTGGCTGGTGCCATTACGATGTTGCTTACTGATCGTAATATTAATACATCTTTTTTTGATCCTGNGGGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema hanleyianum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2ac

Version
3.1

Year Assessed
2012

Assessor/s
Cummings, K. & Cordeiro, J.

Reviewer/s
Bohm, M., Seddon, M. & Collen, B.

Contributor/s
Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., Milligan, HT, De Silva, R., Herdson, R., Thorley, J., McMillan, K., Collins, A., Offord, S., Duncan, C. & Richman, N.

Justification
Pleurobema hanleyianum has been assessed as Critically Endangered under criteria A2ac, as this species has experienced declines of well over 90% of its historical range. This is estimated to translate into at least 80% reduction in range and population size since the 1950s (or three average generation lengths), to the point where it was officially declared extinct by the IUCN in 1994. However, recent rediscovery means that the Georgia pigtoe is currently only known from a few isolated shoals in the Conasauga River. This species has been extirpated from Alabama (Mirarchi et al. 2004, Mirarchi 2004) where it was endemic to the Mobile basin.

History
  • 2000
    Extinct
  • 1996
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 12/02/2010
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pleurobema hanleyianum , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: This species has experienced a tremendous reduction in number of locations and population size recently to the point where it was officially declared extinct by the IUCN in 1994. Recently, a single subpopulation with only a few live individuals was found in a very localized portion of the upper Conasauga River in Georgia. Otherwise, a collection of recently dead shells (1997-1998) and a recently discovered population in the Upper Conasauga River are all that remain of the global population of this species which has experienced an extensive reduction in former range. It has recently been listed by USFWS as an endangered species and Critical Habitat designated. Up until recently, it had formerly been thought extinct.

Intrinsic Vulnerability: Highly vulnerable

Comments: Threats are compounded by their restricted range and low numbers. This species is vulnerable to random catastrophic events (e.g., flood scour, drought, toxic spills, etc.). Limited range and low numbers also make the species vulnerable to land use changes within the Conasauga River watershed that would result in increases in non-point source pollution impacts (USFWS, 2003; 2010).

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Recent collections yielded a few shells from localized portions of one river and a single live individual only. There exist recent collections of a few live and fresh dead shells of this species from localized portions of the upper Conasauga River in Murray and Whitfield counties, Georgia (USFWS 2003). This species has been recently reported as a relict shell from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Polk Co., Tennessee (Johnson et al. 2005). Williams and Hughes (1998) cite potential records for Pleurobema perovatum in the Conasauga River drainage in Georgia, but both P. Johnson and P. Hartfiled believe that Georgia records for Pleurobema perovatum actually represent another Pleurobema (probably Pleurobema hanleyianum), but a consensus has not yet been reached (J. Wisniewski pers. comm. 2007). A specimen from Chewacla Creek (Macon Co., Alabama) in the Tallapoosa River drainage (USFWS 2000, 2004) was initially identified as Pleurobema perovatum, but the specimen has subsequently been identified genetically as Pleurobema hanleyianum (D. Campbell pers. com. 2004).

In 1990, the U.S. Fish and Wildlife Service initiated a status survey and review of the molluscan fauna of the Mobile River Basin reported 14 species of mussels in the genus Pleurobema, including the Painted Clubshell, Georgia Pigtoe, and Alabama Clubshell, as presumed extinct in the Mobile River Basin, based on their absence from collection records, technical reports, or museum collections for a period of 20 years or more (USFWS 1994). The species was considered extinct by the IUCN (Baillie and Groombridge 1996) in 1994. Recent occurrences are only represented at 1 or 2 localities and only by a handfull of live individuals, dead, or recently dead shell material (USFWS 2003). This species is thought to have been extirpated from well over 90% of its historic range (USFWS 1999, 2003) and is now only known from a few recently dead shells (USFWS 2003) and a single live individual indicating populations are likely no longer viable or extremely small. These declines are likely to have occurred over the past 80 to 100 years (J. Cordeiro pers. comm. 2012). Taking a generation length of at least 13 years (probably more like 20 years) into account, and assuming constant decline, we estimate that there has been a decline in over 80% of this species range since the 1950s-1970s. Since the species is very rare where it occurs, this is likely to translate into a similar percentage decline of the population size.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: This species is thought to be extirpated from over 90 percent of its historic range (USFWS, 1999; 2003; 2009). In 1990, the U.S. Fish and Wildlife Service initiated a status survey and review of the molluscan fauna of the Mobile River Basin reported 14 species of mussels in the genus Pleurobema, including the painted clubshell, Georgia pigtoe, and Alabama clubshell, as presumed extinct in the Mobile River Basin, based on their absence from collection records, technical reports, or museum collections for a period of 20 years or more (USFWS, 1994). The species was considered extinct by the IUCN (Baillie and Groombridge, 1996) in 1994. Recent occurrences are only represented at 1 or 2 localities and only by a handfull of live individuals, dead, or recently dead shell material a 43 km reach of the Upper Conasauga River in Murray and Whitfield Cos., Georgia, and in Polk Co., Tennessee (USFWS, 2010).

Global Long Term Trend: Decline of >90%

Comments: The Georgia pigtoe was historically reported from the Conasauga River in Tennessee and Georgia; the Coosawatee, Oostanaula, Coosa, and Etowah Rivers in Georgia; and the Coosa River and tributaries Big Wills, Terrapin, Big Canoe, Yellowleaf, Waxahatchee, Talledega, and Hatchet Creeks, in Alabama. Historical range included more than 480 km of river and stream channels but has declined to where it now occupies only a 43 km reach of the Upper Conasauga River in Murray and Whitfield Cos., Georgia, and in Polk Co., Tennessee. Pleurobema hanleyianum has been extirpated from well over 90 percent of their historic range (USFWS, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat loss (dams, channelization, disappearance of suitable shoal habitat, pollution) is the primary cause of this species' decline. There has been extensive impoundment of the Coosa River and its primary tributaries, and the effects of point and non-point source pollution on the surviving isolated populations.

Isolated populations are vulnerable to land surface runoff that affects water quality or the suitability of aquatic habitats within a watershed. Blocked from avenues of emigration to less affected watersheds, they gradually perish if changes in land use activities cause aquatic habitat conditions to deteriorate. While the detrimental effect of any one source or land use activity may be insignificant by itself, the combined effects of land use runoff within a watershed may result in gradual and cumulative adverse impacts to isolated populations and their habitats. Excessive nutrient input from multiple sources (e.g, nitrogen and phosphorus from fertilizer, sewage waste, animal manure, etc.) into an aquatic system can also have negative cumulative effects (USFWS 2003).

Threats are compounded by their restricted range and low numbers. This species is vulnerable to random catastrophic events (e.g., flood scour, drought, toxic spills, etc.). Limited range and low numbers also make the species vulnerable to land use changes within the Conasauga River watershed that would result in increases in non-point source pollution impacts (USFWS 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: Very high - high

Comments: Much of the information contained herein was derived from USFWS (2003; 2010):
About 50 percent (161 km (100 miles)) of the historic habitat of this species is affected by dams. Rivers impounded by dams have reduced water velocities, allowing sediments to accumulate on river channel habitats behind dams. Impounded waters also experience changes in water chemistry, which can affect survival or reproduction of riverine snails. The disappearance of shoal populations from unimpounded relict habitats in the Coosa River drainage is likely due to historical pollution problems. Prior to the passage of the Clean Water Act and the adoption of State water quality criteria, water pollution may have been a significant factor in the disappearance of populations from unimpounded portions of river channels. Short-term and long-term impacts of point and non-point source water and habitat degradation continue to be a primary concern for the survival of this species. Point source discharges and land surface runoff (non-point pollution) can cause nutrification, decreased dissolved oxygen concentration, increased acidity and conductivity, and other changes in water chemistry that are likely to seriously impact aquatic snails. Point sources of water quality degradation include municipal and industrial effluents. Non-point source pollution from land surface runoff can originate from virtually any ground-disturbing land use activity and may include sediments, fertilizers, herbicides, pesticides, animal wastes, septic tank and gray water leakage, and oils and greases. This species is not commercially utilized and scientific collecting is not considered a factor in the decline of the species. The potential now exists for the black carp (Mylopharyngodon piceus), a mollusk-eating Asian fish recently introduced into the waters of the United States, to eventually enter and disperse through the Mobile River Basin via the Tennessee-Tombigbee Waterway, or by their accidental release from catfish farms or other aquaculture facilities. There is a growing concern that climate change may lead to increased frequency of severe storms and droughts. During 2007 and 2008, a severe drought affected the Coosa River watershed in Alabama and Georgia. Streamflow for the Conasauga River at Tilton, Georgia, during September 2007, was the lowest recorded for any month in 69 years. Although the effects of the drought have not been quantified, mollusk declines as a direct result of drought have been documented. Because these animals are only capable of moving short distances and there are numerous obstacles in the Coosa River drainage preventing long distance movement of freshwater mollusks between relict patches of historically occupied and potentially suitable riverine habitats, following potential climate change events, populations will likely be unable to recolonize those areas without human assistance.

Causes of the decline can be attributed to extensive impoundment of the Coosa River and its primary tributaries, and the effects of point and non-point source pollution on the surviving isolated populations. Isolated populations are vulnerable to land surface runoff that affects water quality or the suitability of aquatic habitats within a watershed. Blocked from avenues of emigration to less affected watersheds, they gradually perish if changes in land use activities cause aquatic habitat conditions to deteriorate. While the detrimental effect of any one source or land use activity may be insignificant by itself, the combined effects of land use runoff within a watershed may result in gradual and cumulative adverse impacts to isolated populations and their habitats. Excessive nutrient input from multiple sources (e.g, nitrogen and phosphorus from fertilizer, sewage waste, animal manure, etc.) into an aquatic system can also have negative cumulative effects (USFWS, 2003; 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species has been assigned a NatureServe Global Heritage Status Rank of G1 - Critically Imperiled (NatureServe 2009). This species is a U.S. Fish and Wildlife Service candidate species for federal endangered status.

All riparian lands are in corporate or private ownership. This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Polk Co., Tennessee (Johnson et al. 2005). The U.S. Fish and Wildlife Service is working to establish a National Wildlife Refuge in the upper Conasauga River. Watershed management outreach has been conducted. The Nature Conservancy has conducted a watershed impact analysis for the Conasauga River watershed. Surveys are ongoing, and genetic studies will be continuing to clarify and confirm taxonomy of this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: All riparian lands are in corporate or private ownership. This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Polk Co., Tennessee (Johnson et al., 2005). The U.S. Fish and Wildlife Service is working to establish a National Wildlife Refuge in the upper Conasauga River. Watershed management outreach has been conducted. The Nature Conservancy has conducted a watershed impact analysis for the Conasauga River watershed. Surveys are ongoing (USFWS, 2009). The species has been listed as endangered species and 148 km of Critical Habitat designated in the Conasauga River in Bradley and Polk Co., Tennessee and Murray and Whitfield Cos., Georgia; Terrapin Creek and the Coosa River in Cherokee Co., Georgia; and Hatchet Creek in Clay and Coosa Cos., Alabama (USFWS, 2010).

Needs: The U.S. Fish and Wildlife Service is working to establish a National Wildlife Refuge in the upper Conasauga River. Watershed management outreach has been conducted. The Nature Conservancy has conducted a watershed impact analysis for the Conasauga River watershed. Surveys are ongoing, and genetic studies will be continuing to clarify and confirm taxonomy of this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: This species was recently designated as endangered by the U.S. Fish and Wildlife Service with 148 km of Critical Habitat designated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Georgia pigtoe

The Georgia pigtoe (Pleurobema hanleyianum) is a rare species of freshwater mussel in the Unionidae family. It is native to Alabama, Georgia, and Tennessee in the United States, where it has been extirpated from most of its historical range. It was declared extinct by the IUCN,[1] but a few living individuals were discovered persisting in the Conasauga River in Georgia[2] and Tennessee.[3] It was federally listed as an endangered species in 2010.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Spelling of the name follows the original publication (Turgeon et al., 1998). It is difficult to differentiate this species from Pleurobema georgianum and Pleurobema trochelianum in the field due to similar shell characteristics (Parmalee and Bogan, 1998), but some morphological features of each are outlined in USFWS (2003). Recent genetic studies were unable to distinguish the painted clubshell from the southern clubshell (listed as endangered), or populations of Georgia pigtoe and Alabama clubshell from southern pigtoe (listed as endangered) (P. Johnson, Tennessee Aquarium, pers. comm. 2002). The uniqueness of the species has been verified morphologically (Williams et al., 2008) and genetically (Campbell et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!