Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (250-1000 square km (about 100-400 square miles)) It is endemic to the Coosa River drainage of the Mobile Basin in Alabama, Georgia, and Tennessee (Williams et al., 2008). It is extant in a few widely scattered tributaries of Coosa River including some streams in Talladega National Forest (Mirarchi et al., 2004; Williams et al., 2008). Recently fresh dead shells (identified as P. troschelianum) were collected in the upper Conasauga River (USFWS, 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (AL, GA, TN)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species inhabits high quality rivers (small rivers to large streams) in shoals and runs with stable gravel and sandy-gravel substrates (USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: The species is currently known to survive in the Conasauga River (Murray/Whitfield County, Georgia and Bradley County, Tennessee), Holly Creek (Murray County, Georgia), Shoal Creek (Cleburne County, Alabama), Big Canoe Creek (St. Clair County, Alabama), and Cheaha Creek (Talladega County, Alabama) (USFWS, 2000; 2004; Parmalee and Bogan, 1998; also USFWS, 2003 as P. troschelianum). It is extant in a few widely scattered tributaries of Coosa River including some streams in Talladega National Forest and in the Conasauga River (Mirarchi et al., 2004; Williams et al., 2008). This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia, and Polk Co., Tennessee (Johnson et al., 2005; Ryan Evans, PA NP, pers. comm., 2005); as well as Holly Creek, adjacent to the Chattahoochee National Forest, Murray Co., Georgia (Johnson et al., 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The glochidial host is not known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema georgianum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTATGATCTGGTTTGATTGGGTCGGCTCTGAGTCTTTTGATTCGAGCTGAGTTAGGGCAACCTGGTAGGTTGTTGGGAGAT---GATCAATTATATAATGTGATTGTGACAGCTCACGCTATTATAATGATTTTTTTCTTGGTGATACCTATGATGATTGGAGGTTTTGGTAATTGGCTTATTCCTCTTATGATTGGGGCTCCTGACATGGCTTTTCCTCGATTGAATAATTTAAGGTTTTGGTTACTTGTACCTGCTCTGTTTTTATTATTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGGACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGAGCTTCAGTAGATTTGGCTATTTTTTCTTTACATCTTGCTGGTGCATCCTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTTGGGAATATGCGATCTCCTGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTATGGGCTGTGACAGTGACAGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCCATTACGATGTTGCTTACTGATCGTAATATTAATACATCTTTTTTTGATCCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema georgianum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: This species is known from just a handful of records in one river system and has experienced a greater than 70% decline in recent years. Although about a half dozen occurrences are known, all are widely scattered, localized, and small. Recovery is unlikely and the species continues to face ongoing threats of habitat loss and degradation.

Intrinsic Vulnerability: Highly to moderately vulnerable.

Comments: Isolated imperiled populations in the Mobile River basin are likely vulnerable to random accidents, such as toxic spills, and to naturally catastrophic events, such as droughts and floods, even if land use and human populations were to remain constant within isolated watersheds (USFWS, 2000). Threats are compounded by their restricted range and low numbers. The three species are vulnerable to random catastrophic events (e.g., flood scour, drought, toxic spills, etc.). Limited range and low numbers also make the species vulnerable to land use changes within the Conasauga River watershed that would result in increases in non-point source pollution impacts (USFWS, 2003).

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: This species inhabits high quality rivers (small rivers to large streams) in shoals and runs with stable gravel and sandy-gravel substrates (USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce+2ce

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/17/1993
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pleurobema georgianum , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 50-70%

Comments: This species has declined significantly throughout its range.

Global Long Term Trend: Decline of 50-70%

Comments: The historic range of Pleurobema georgianum included the Coosa River and its tributaries in Alabama, Georgia, and Tennessee (USFWS, 2000; 2004). Museum records indicate its presence in the Coosa River, Shoal Creek, and the Chatooga and Conasauga rivers. Recently (1987-1991) known from just a handful of records (USFWS, 1993). Pleurobema nucleopsis, now considered a synonym, is known historically in the Coosa River basin in Georgia from the Etowah River drainage but has not been collected there recently and is presumed extirpated (Williams and Hughes, 1998). The University of Michigan Museum of Zoology maintains collected specimens labeled Pleurobema nucleopsis from the Conasauga River (Murray and Whitfield Cos.), Coosawattee River (Murray Co.), Etowah River in Georgia (the type locality); and Terrapin Creek (Cherokee Co.), Little River (Cherokee Co.), Cahaba River (Bibb, Jefferson, Shelby, and other Cos.), Beeswax Creek (Shelby Co.), Buck Creek (Shelby Co.), and Coosa River (Shelby and other Cos.) in Alabama. Pleurobema troschelianum, now considered a synonym, is known historically from the Conasauga and Coosawattee River drainages (Williams and Hughes, 1998) plus the Conasauga River in Tennessee and Georgia, the Chatooga, Coosawatee and Oostanaula rivers and Coahutta Creek in Georgia, and the Middle Coosa River and Terrapin, Shoal, and Hatchet creeks in Alabama (USFWS, 1999; 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Causes of the decline can be attributed to extensive impoundment of the Coosa River and its primary tributaries, and the effects of point and non-point source pollution on the surviving isolated populations. Isolated populations are vulnerable to land surface runoff that affects water quality or the suitability of aquatic habitats within a watershed. Blocked from avenues of emigration to less affected watersheds, they gradually perish if changes in land use activities cause aquatic habitat conditions to deteriorate. While the detrimental effect of any one source or land use activity may be insignificant by itself, the combined effects of land use runoff within a watershed may result in gradual and cumulative adverse impacts to isolated populations and their habitats. Excessive nutrient input from multiple sources (e.g, nitrogen and phosphorus from fertilizer, sewage waste, animal manure, etc.) into an aquatic system can also have negative cumulative effects (USFWS, 2003). Disappearance from significant portions of its range are primarily due to changes in river and stream channels due to dams, dredging, or mining, and historic or episodic pollution events. The species is not known to survive in impounded waters and more than 1700 km of large and small river habitat in the Basin have been impounded by dams for navigation, flood control, water supply, and/or hydroelectric production purposes (USFWS, 2004).

From USFWS (2000):
In the Mobile River basin, the greatest threats are dams (for navigation, water supply, electricity, recreation, and flood control), channelization (causing accelerated erosion, altered depth; and loss of habitat diversity, substrate stability, and riparian canopy), dredging (for navigation or gravel mining), mining (for coal, sand, gravel, or gold) in locally concentrated areas, pollution- point source (industrial waste effluent, sewage treatment plants, carpet and fabric mills, paper mills and refineries in mainstem rivers), pollution- nonpoint source (construction, agriculture, silviculture, urbanization).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Extant in a few widely scattered tributaries of Coosa River including some streams in Talladega National Forest (Mirarchi et al., 2004). The U.S. Forest Service has funded mussel surveys in streams under its jurisdiction, and has strengthened stream management zone guidelines on Forest Service lands in Alabama (USFWS, 2000). This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia, and Polk Co., Tennessee (Johnson et al., 2005). Critical habitat has been designated in Alabama in the Coosa River, Hatchet Creek, Kelly Creek, Cheaha Creek, Yellowleaf Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (197 occuppied, 322 unoccuppied km) (USFWS, 2004).

Needs: Critical habitat being proposed in 9 units across distribution in Mobile Basin (USFWS, 2004). Mobile River Basin recovery plan (USFWS, 2000) calls for: (1) use to fullest extent existing laws, regulations, and policies to portect listed populations and their habitats, and to develop and encourage a stream management strategy that places high priority on conservation; (2) encourage voluntary stewardship through joint initiatives and individual actions as the only practical and economical means of minimizing adverse effects of private land use and activities within watersheds; (3) continue to promote research efforts on life histories, sensitivities, and requirements of imperiled aquatic species, and develop technological capabilities to maintain and propagate them.

The Service is working to establish a National Wildlife Refuge in the upper Conasauga River. Watershed management outreach has been conducted. The Nature Conservancy has conducted a watershed impact analysis for the Conasauga River watershed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: This species was listed as federally endangered in the U.S. in 1993. Recovery to the point of downlisting to threatened is unlikely in the near future. The immediate recovery objective is to prevent the extinction of this species by locating, protecting, and restoring stream drainages with extant populations (USFWS, 2000).

A specific recovery plan has been created for the Mobile River basin (USFWS, 2000) which contains the following objectives: (1) protect habitat integrity and quality of river and stream segments that currently support or could support imperiled aquatic species, (2) consider options for free-flowing river and stream mitigation strategies that give high priority to avoidance and restoration, (3) promote voluntary stewardship as a practical and economical means of reducing nonpoint pollution from private land use, (4) encourage and support community based watershed stewardship planning and action, (5) develop and implement programs and materials to educate the public on the need and benefits of ecosystem management, and to involve them in watershed stewardship, (6) conduct basic research on endemic aquatic species and apply the results toward management and protection of aquatic communities, (7) develop and implement technology for maintaining and propagating endemic species in captivity, (8) reintroduce aquatic species into restored habitats, as appropriate, (9) monitor listed species population levels and distribution and periodically review ecosystem management strategy, (10) coordinate ecosystem management actions (more detail in USFWS, 2000).

Critical habitat has been designated in Alabama in the Coosa River, Hatchet Creek, Kelly Creek, Cheaha Creek, Yellowleaf Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (197 occuppied, 322 unoccuppied km) (USFWS, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Southern pigtoe

The southern pigtoe, common name Pleurobema georgianum, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: It is difficult to differentiate this species from Pleurobema troschelianum and Pleurobema hanleyianum in the field due to similar shell characteristics (Parmalee and Bogan, 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!