Overview

Distribution

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (<100 square km (less than about 40 square miles)) The type locality of Pleurobema furvum is the Black Warrior River, Alabama. Historically, the species was probably restricted to the Black Warrior River system above the fall line (USFWS, 2004). Additional records include the headwaters of the Sipsey Fork and the Locust Fork of the Black Warrior River. Recent records include the North River above Lake Tuscaloosa (USFWS, 1993). The current range is limited to the tributaries of the Sipsey Fork, Winston County, and the North River in Tuscaloosa and Fayette Counties and its tributary Clear Creek, Fayette County, all in Alabama (Vittor and Associates, 1993; USFWS, 1993; Mirarchi et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (AL)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 6 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Pleurobema furvum may be confused with specimens of Pleurobema rubellum. This may be attributed to the scarcity of recent specimens of either species and the incorrect identification of certain specimens. P. rubellum is a smaller species which is suborbicular in outline. The beaks are more centrally located and it has pink or purplish nacre. P. furvum may also be confused with Pleruobema georgianum which is more elliptical in shape. It is not pointed posteriorly and is more compressed than P. furvum. Its hinge plate and teeth are smaller. The periostracum is yellow to yellow-brown, occasionally with broken green rays along the posterior slope and ridge. P. georgianum has white nacre (U. S. Fish and Wildlife Service, 1993). In the North River,Tuscaloosa and Fayette Counties, Alabama, P. furvum may be confused with Pleurobema hagleri. P. hagleri is elliptically oval is shape. The periostracum is pale brown to reddish brown and usually has a lustrous or shiny surface. The hinge plate and teeth are smaller, The shell is generally more compressed than P. furvum. The nacre is white, purplish or salmon red, becoming thin and irridescent posteriorly (Shelton and Way, in prep; Simpson, 1914).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species is generally found in highly oxygenated, clear streams with moderate flow. It may be found in sand, but is usually found in a sand and gravel substrate in small rivers and large streams (Doug Shelton, pers. obs., 1996; USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Since its listing, the species has been confirmed in the Black Warrior River drainage from Sipsey Fork and its tributaries (Caney, Brown, Rush, and Capsey Creeks in Winston/Lawrence County, Alabama); and from the North River and its tributary Clear Creek (Fayette County, Alabama). Badly weathered shells have also been found in the Locust Fork of the Black Warrior River near the Jefferson-Blount County line (USFWS, 2000; 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

250 - 2500 individuals

Comments: It is most common in the tributaries to the Sipsey Fork, Winston County, Alabama, but is generally rare wherever it is found. Numerous surveys have targeted the species, but exact population estimates are unavailable (Pierson, 1992; Vittor and Associates, 1993; Shelton, 1996; USFWS, 1993). Densities here were from 0 to 4.8/square meter (USFWS, 2004). At least 8 locations are known within Bankhead National Forest streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Freshwater mussel larvae (glochidia) are brooded in the gills of the female and when mature are released into the water where they spend a brief period as obligate parasites on the gills, fins, or other external parts of fish until they drop off to the benthos. In the laboratory, Haag and Warren (1997) identified the following fish as suitable hosts for Pleurobema furvum: Campostoma oligolepis (largescale stoneroller), Cyprinella callista (Alabama shiner), Cyprinella venusta (blacktail shiner), Semotilus atromaculatus (creek chub), and Fundulus olivaceus (blackspotted topminnow). Haag and Warren (1997) also noted that it released its glochidia in conglutinates that may mimic food items of darters and minnows. Females were found gravid with mature glochidia from mid to late June in water temperatures of 25 degrees C (Haag and Warren, 1997). The species is gravid in June and releases glochidia in peach to pink-colored conglutinates (Haag and Warren, 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema furvum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTGGTTTGATTGGGTTGGCTCTGAGTCTTTTAATTCGAGCTGAGTTGGGGCAACCTGGTAGGTTGTTGGGGGAT---GATCAATTATATAATGTGATTGTGACGGCACATGCTTTTATAATAATTTTTTTCTTGGTGATACCTATAATAATTGGGGGTTTTGGTAATTGGCTTATTCCTCTTATGATTGGGGCTCCAGATATGGCTTTTCCTCGATTAAATAATTTGAGGTTTTGGTTGCTTGTACCTGCTTTGTTTTTATTATTGAGGTCTTCTTTGGTGGAGAGAGGTGTTGGAACTGGTTGAACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGGGCTTCGGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTGGGGAATATGCGGTCTCCCGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTATGGGCTGTGACAGTAACAGCGGTTTTATTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCCATTACGATGTTGCTTACTGATCGTAATATTAACACATCTTTTTTTGATCCTGTTGGGGGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema furvum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: This is a declining regional endemic which is limited to only two small drainage areas and is vulnerable to present and potential threats. It has declined to a fraction of its former occupied habitat and any further loss of habitat could mean the extinction of this species.

Intrinsic Vulnerability: Highly to moderately vulnerable.

Comments: Isolated imperiled populations in the Mobile River basin are likely vulnerable to random accidents, such as toxic spills, and to naturally catastrophic events, such as droughts and floods, even if land use and human populations were to remain constant within isolated watersheds (USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce+2ce

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/17/1993
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pleurobema furvum , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: It has been in decline for some time, largely due to impoundments. Much of its former range is impounded.

Global Long Term Trend: Decline of 70-90%

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Only the upper North River and the tributaries to the Sipsey Fork remain free flowing. A proposed impoundment in the headwaters of the North River will alter the flow of the water to the remaining habitat there, so habitat modification, sedimentation, and water quality degredation represent the major threats to the species. It may also be threatened by overutilization for commercial, recreational, scientific or educational purposes (USFWS, 1993). In the North River sedimentation from head-cuts appears to be the major threat to the species (Doug Shelton, pers. obs. 1996). Pierson (1992) reported runoff from previous mining operations as a possible threat. Disappearance from significant portions of its range are primarily due to changes in river and stream channels due to dams, dredging, or mining, and historic or episodic pollution events. The species is not known to survive in impounded waters and more than 1700 km of large and small river habitat in the Basin have been impounded by dams for navigation, flood control, water supply, and/or hydroelectric production purposes (USFWS, 2004).

From USFWS (2000):
In the Mobile River basin, the greatest threats are dams (for navigation, water supply, electricity, recreation, and flood control), channelization (causing accelerated erosion, altered depth; and loss of habitat diversity, substrate stability, and riparian canopy), dredging (for navigation or gravel mining), mining (for coal, sand, gravel, or gold) in locally concentrated areas, pollution- point source (industrial waste effluent, sewage treatment plants, carpet and fabric mills, paper mills and refineries in mainstem rivers), pollution- nonpoint source (construction, agriculture, silviculture, urbanization).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: 1. Conduct life history studies with an emphasis on fish host identification. 2. Perform genetic analysis of the population in the Sipsey Fork drainage to specimens of Pleurobema furvum and specimens believed to be Pleurobema hagleri from the North River. 3. Determine if culturing of the species is a viable means of conservation. 4. Assess potential sites for reintroduction prove successful.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: The populations in the headwaters of the Sipsey Fork are found in streams which originate and flow through the Bankhead National Forest and the U.S. Forest Service has implemented improved stream management zone guidelines there (USFWS, 2000). Critical habitat has been designated in Alabama in the Sipsey Fork, North River, and Locust Fork (194 occuppied, 102 unoccuppied km) (USFWS, 2004).

Needs: Critical habitat being proposed in 3 units across distribution in Mobile Basin (USFWS, 2004). Mobile River Basin recovery plan (USFWS, 2000) calls for: (1) use to fullest extent existing laws, regulations, and policies to portect listed populations and their habitats, and to develop and encourage a stream management strategy that places high priority on conservation; (2) encourage voluntary stewardship through joint initiatives and individual actions as the only practical and economical means of minimizing adverse effects of private land use and activities within watersheds; (3) continue to promote research efforts on life histories, sensitivities, and requirements of imperiled aquatic species, and develop technological capabilities to maintain and propagate them.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: This species was listed as federally endangered in the U.S. in 1993.

A specific recovery plan has been created for the Mobile River basin (USFWS, 2000) which contains the following objectives: (1) protect habitat integrity and quality of river and stream segments that currently support or could support imperiled aquatic species, (2) consider options for free-flowing river and stream mitigation strategies that give high priority to avoidance and restoration, (3) promote voluntary stewardship as a practical and economical means of reducing nonpoint pollution from private land use, (4) encourage and support community based watershed stewardship planning and action, (5) develop and implement programs and materials to educate the public on the need and benefits of ecosystem management, and to involve them in watershed stewardship, (6) conduct basic research on endemic aquatic species and apply the results toward management and protection of aquatic communities, (7) develop and implement technology for maintaining and propagating endemic species in captivity, (8) reintroduce aquatic species into restored habitats, as appropriate, (9) monitor listed species population levels and distribution and periodically review ecosystem management strategy, (10) coordinate ecosystem management actions (more detail in USFWS, 2000).

Critical habitat has been designated in Alabama in the Sipsey Fork, North River, and Locust Fork (194 occuppied, 102 unoccuppied km) (USFWS, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dark pigtoe

The dark pigtoe, scientific name Pleurobema furvum, is a species of freshwater mussel in the family Unionidae, the river mussels. This aquatic bivalve mollusk is native to Alabama in the United States, where it is mainly limited to the Black Warrior River. It is a federally listed endangered species of the United States.[1]

References

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Williams et al. (2008) treat as a synonym of Pleurobema rubellum based on conchological characters and preliminary genetic analyses.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!