Overview

Distribution

Global Range: (5000-20,000 square km (about 2000-8000 square miles)) Formerly widespread throughout the Mobile River basin, Pleurobema decisum was known historically from the Alabama River and Bogue Chitto Creek; Tombigbee River and tributaries (Buttahatchie, East Fork Tombigbee, and Sipsey Rivers and Bull Mountain, Luxapalila, and Lubbub Creeks); Black Warrior River; Cahaba and Little Cahaba Rivers; two Tallapoosa tributaries, Uphapee and Chewacla Creeks; and the Coosa River and tributaries (Oostanaula, Conasauga, Etowah, Chatooga, and Coosawattee Rivers and Kelly, Talladega and Shoal Creeks) in Mississippi, Alabama, Georgia, and Tennessee (USFWS, 2004). Currently, the species is known from Bogue Chitto Creek in Alabama River drainage; Buttahatchie, East Fork Tombigbee and Sipsey Rivers in the Tombigbee River drainage; and Chewacla Creek in the Tallapoosa River drainage (U. S. Fish and Wildlife Service 1993; McGregor et. al. 1999). It has recently been found in the Conasauga River, Whitfield and Murray Counties, Georgia in the upper Coosa River drainage (Mark Hughes, pers. comm. 2/10/1997). In the Coosa River basin in Georgia, it is known historically from the Coosa, Etowah, Oostanaula, Conasauga, and Coosawattee River drainages but has not been collected there recently (Williams and Hughes, 1998) except in the Conasauga (Johnson et al., 2005). Mirarchi et al. (2004) and Williams et al. (2008) list distribution as endemic to Mobile Basin in Alabama, Georgia, and Mississippi including Alabama, Black Warrior, Cahaba, Coosa, Tallapoosa, and Tombigbee River systems with large populations remaining only in widely scattered localities in Tombigbee River system (may be extirpated from Black Warrior and Cahaba). Jones et al. (2005) list the Tombigbee River drainage in Mississippi. McGregor et al. (2000) failed to find this species in the Cahaba River, Alabama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AL, GA, MS, TN)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 7 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pleurobema decisum is distinguished from a closely related species, Pleurobema curtum by its elongate shape, lighter color, and presence of a well-defined sulcus in the latter species (U. S. Fish and Wildlife Service, 1993). Pleurobema chattanoogaensis of the upper Coosa River drainage is similar in shape and appearance, but may separated by the rounded posterior end of P. chattanoogaensis as compared to the sharp posterior end of P. decisum. Identification problems may also exist with specimens of Pleurobema murrayensis (Doug Shelton, pers. obs. 1996). The status of P. murrayensis is unknown and it may be extinct.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in flowing water in large creeks and rivers. It is usually found in substrates composed of gravel with interstitial sand. Usually found in highly oxygenated streams with sand and gravel substrate in shoals of large rivers to small streams; may be found in sand and gravel in the center of the stream or in sand along the margins of the stream (Shelton pers. obs. 1995, USFWS 2000).

This species has been reported to reach sexual maturity when as small as 26.3 mm (Haag and Staton 2003) but grows to about 70 mm (2.8 in) long with a thick shell (USFWS 2000). It is a short-term brooder, gravid from late May to late July, with glochidia mature by the second week of June (Haag and Warren 2003). Haag and Staton (2003) estimated 94% of females in a population to be gravid during the peak of the brooding period. Glochidia are released in conglutinates that are ovate in outline, thin and orange or white (Haag and Staton 2003, Haag and Warren 2003). In addition to glochidia, P. decisum conglutinates are composed of undeveloped eggs, which are believed to help maintain the conglutinate integrity. Percentage of undeveloped eggs in P. decisum conglutinates has been reported to average 47% (Haag and Staton 2003). Annual fecundity was found to be variable in two Sipsey River, Alabama, populations, averaging 29,433 glochidia per female in one and 40,887 per female in the other (Haag and Staton 2003). One primary glochidial host, Cyprinella venusta (Blacktail Shiner) (Cyprinidae), and one secondary host, Luxilus chrysocephalus (Striped Shiner) (Cyprinidae), were reported based on laboratory trials (Haag and Warren 2003) (Williams et al. 2008). Females first become gravid at 2-3 years, maximum age is 40 years, and the generation length of the species is 18-19 years (A. Bogan pers. comm. 2012).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Usually found in highly oxygenated streams with sand and gravel substrate in shoals of large rivers to small streams; may be found in sand and gravel in the center of the stream or in sand along the margins of the stream (Doug Shelton, pers. obs. 1995; USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Except for the Mobile Delta, this species was known from every major stream system in the Mobile River basin. It is now limited to approximately six viable populations. The Sipsey River in the Tombigbee River drainage and Chewacla Creek in the Tallapoosa River drainage support two of the most sizable populations. The known populations are isolated from each other. The species continues to inhabit the East Fork Tombigbee River (Itawamba/Monroe Co., Mississippi), Bull Mountain Creek, Buttahatchee River (Monroe/Lowndes Co., Mississippi), Luxapalila and Yellow Creeks (Lowndes Co., Mississippi), Lubbub Creek, and Sipsey River (Greene/Pickens/Tuscaloosa Co., Alabama) in the Tombigbee River drainage. It also inhabits a short reach of the Alabama River and Boque Chitto Creek (Dallas County, Alabama), Chewacla Creek (Macon Co., Alabama); Coosa River below Weiss dam (Cherokee Co., Alabama) and tributaries Kelly Creek (Shelby Co., Alabama), Big Canoe Creek (St. Clair Co., Alabama), Terrapin Creek (Cherokee Co., Alabama), and Conasauga River (Murray/Whitfield Co., Georgia) (USFWS, 2000; 2004). This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia (Johnson et al., 2005). Johnson and Ahlstedt (2005) located specimens in 2005 in the Luxapallila drainage on the Mississippi/Alabama border. This species was historically collected from the upper Tombigbee River in Sumter and Greene Cos., Alabama, prior to impoundment (Williams et al., 1992). McGregor et al. (1999) documented it in the Bogue Chitto Creek, Alabama River drainage, Alabama.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

1000 - 2500 individuals

Comments: It is most common in the Sipsey River, Tombigbee River drainage; Chewacla Creek, Tallapoosa River drainage; and the Conasauga River, the upper Coosa River drainage. It is usually rare where ever it is found. Average density at four sites in the Coosa River below Weiss Damn was 0.19/square meter (Herod et al., 2001) and it is rare to uncommon at other occupied streams.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Gravid females with mature glochidia have been collected in June and July. Glochidia are released in well formed conglutinates orange or white in coloration. Fish hosts include Cyprinella venusta, Cyprinella callista, and Cyprinella trichroistia (Haag and Warren, 2001, FWS, 2003). This species is a short-term brooder gravid from late spring to early summer. Glochidia are released in well formed conglutinates in bursts that drift on the water column and fish hosts include Cyprinella venusta only (Haag and Warren, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema decisum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTATGATCTGGTTTGATTGGGTTGGCTTTGAGTCTTTTGATTCGGGCTGAGCTAGGGCAACCTGGTAGGTTGTTGGGAGAT---GATCAATTGTATAATGTGATTGTGACAGCGCATGCTTTTATGATAATTTTCTTCTTGGTGATACCTATGATGATTGGGGGTTTTGGAAATTGGCTTATTCCTCTTATGATTGGGGCTCCCGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGGTTACTTGTGCCTGCTCTCTTTTTGTTATTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGGACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATCTCCACTGTGGGGAATATACGATCTCCTGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTGTGGGCTGTGACGGTAACAGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTGGCTGGTGCCATTACGATGTTGCTTACTGATCGTAATATTAATACATCTTTTTTTGATCCTGTTGGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema decisum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2c; B1ab(i,ii,iii,iv,v)+2ab(i,ii,iii,iv,v)

Version
3.1

Year Assessed
2012

Assessor/s
Bogan, A. & Cordeiro, J.

Reviewer/s
Bohm, M., Collen, B. & Seddon, M.

Contributor/s
Richman, N., Dyer, E., Soulsby, A.-M., Whitton, F., Kasthala, G., McGuinness, S., Milligan, HT, De Silva, R., Herdson, R., Thorley, J., McMillan, K., Collins, A., Offord, S. & Duncan, C.

Justification
Pleurobema decisum has been assessed as Endangered under criteria A2c;B1ab(i,ii,iii,iv,v)+2ab(i,ii,iii,iv,v) as the species has undergone a steep population reduction, has an inferred extent of occurrence of < 1,000 km2 and area of occupancy of < 500 km2, remaining populations are severely fragmented and isolated and continuing threats from human activities throughout the Mobile River basin are continuing to reduce the area/quality of available habitat, thus resulting in continued declines in EOO, AOO, number of mature individuals and subpopulations. This species is currently known from a few locations within the Mobile River basin, where it was once widespread and faces multiple major threats. The historical decline was approximately 70-80% over the last 25-50 years, but recently has been closer to 60%. Until recently, this species was currently found in only a fraction of its former range with few new occurrences but recent populations have been found in the Conasauga, Luxapallila, and Tombigbee drainages (Cordeiro pers. comm. 2011). The generation length of this species is 18-19, meaning that the species also qualifies as Endangered under criterion A2c due to population declines of over 50% in 3 generation lengths: a 60-80% decline in localities over the past 25-50 years is suspected to equal a population reduction of at least 50% in the past 60 years.

History
  • 2000
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 03/17/1993
Lead Region:   Southeast Region (Region 4) 
Where Listed:


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pleurobema decisum , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G2 - Imperiled

Reasons: This is a declining regional endemic which faces major threats. It had, until recently, declined significantly to only a fraction of its former range but recently a few new populations were discovered on the Conasauga, Luxapallila, and Tombigbee drainages. Still, former area of occupancy included every major drainage system in the Mobile Basin except the Mobile Delta. Any impact to the species is significant and threats continue to be ongoing.

Intrinsic Vulnerability: Highly to moderately vulnerable.

Comments: Isolated imperiled populations in the Mobile River basin are likely vulnerable to random accidents, such as toxic spills, and to naturally catastrophic events, such as droughts and floods, even if land use and human populations were to remain constant within isolated watersheds (USFWS, 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a declining regional endemic which faces major threats. It had, until recently, declined significantly to only a fraction of its former range but recently a few new populations were discovered from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia (Johnson et al. 2005) on the Conasauga, Luxapallila, and Tombigbee drainages.

However its former area of occupancy included every major drainage system in the Mobile Basin except the Mobile Delta. Unfortunately it is now limited to approximately six viable populations.

The Sipsey River in the Tombigbee River drainage and Chewacla Creek in the Tallapoosa River drainage support two of the most sizable populations. The known populations are isolated from each other. The species continues to inhabit the East Fork Tombigbee River (Itawamba/Monroe Co., Mississippi), Bull Mountain Creek, Buttahatchee River (Monroe/Lowndes Co., Mississippi), Luxapalila and Yellow Creeks (Lowndes Co., Mississippi), Lubbub Creek, and Sipsey River (Greene/Pickens/Tuscaloosa Co., Alabama) in the Tombigbee River drainage. It also inhabits a short reach of the Alabama River and Boque Chitto Creek (Dallas County, Alabama), Chewacla Creek (Macon Co., Alabama); Coosa River below Weiss dam (Cherokee Co., Alabama) and tributaries Kelly Creek (Shelby Co., Alabama), Big Canoe Creek (St. Clair Co., Alabama), Terrapin Creek (Cherokee Co., Alabama), and Conasauga River (Murray/Whitfield Co., Georgia) (USFWS 20002004).

Johnson and Ahlstedt (2005) located specimens in 2005 in the Luxapallila drainage on the Mississippi/Alabama border. This species was historically collected from the upper Tombigbee River in Sumter and Greene Cos., Alabama, prior to impoundment (Williams et al. 1992).

The species is relatively common in localised reaches of the Buttahatchee and Sipsey Rivers, but is rare to uncommon in other localities (USFWS 2000, 2004). Large populations remain only in widely scattered localities in Tombigbee River system (may be extirpated from Black Warrior and Cahaba) (Mirarchi et al. 2004).

TRENDS:
The historical decline was approximately 70-80% over the last 25-50 years but recently has been closer to 60%. Until recently, this species was found in only a fraction of its former range with few new occurrences but recent populations have been found in the Conasauga, Luxapallila, and Tombigbee drainages (J. Cordeiro pers. comm. 2011).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: Until recently, this species was currently found in only a fraction of its former range with few new occurrences but recent specimens have been found in the Conasauga, Luxapallila, and Tombigbee drainages.

Global Long Term Trend: Decline of >90%

Comments: Except for the Mobile Delta, this species was formerly known from every major stream system in the Mobile River basin, including the Alabama River and tributaries, Alabama; Tomigbee River and tributaries, Mississippi and Alabama; Black Warrior River and tributaries, Alabama; Cahaba and tributaries, Alabama; Uphapee and Chewacla Creeks, Tallapoosa River drainage, Alabama; Coosa River and tributaries, Alabama, Georgia, and Tennessee; but is now limited to about a half dozen viable populations (USFWS, 2000; 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Habitat modification, sedimentation, and water quality degredation represent the major threats to this species. It may also be threatened by overutilisation for commercial, recreational, scientific or educational purposes (USFWS 1993). Disappearance from significant portions of its range are primarily due to changes in river and stream channels due to dams, dredging, or mining, and historic or episodic pollution events. The species is not known to survive in impounded waters and more than 1700 km of large and small river habitat in the Basin have been impounded by dams for navigation, flood control, water supply, and/or hydroelectric production purposes (USFWS 2004).

In the Mobile River basin, the greatest threats are dams (for navigation, water supply, electricity, recreation, and flood control), channelisation (causing accelerated erosion, altered depth; and loss of habitat diversity, substrate stability, and riparian canopy), dredging (for navigation or gravel mining), mining (for coal, sand, gravel, or gold) in locally-concentrated areas, pollution- point source (industrial waste effluent, sewage treatment plants, carpet and fabric mills, paper mills and refineries in mainstem rivers), pollution- nonpoint source (construction, agriculture, silviculture, urbanisation) (USFWS 2000).

Isolated imperiled populations in the Mobile River basin are likely to be vulnerable to random accidents, such as toxic spills, and to naturally catastrophic events, such as droughts and floods, even if land use and human populations were to remain constant within isolated watersheds (USFWS 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: Very high - high

Comments: Habitat modification, sedimentation, and water quality degredation represent the major threats to the species. It may also be threatened by overutilization for commercial, recreational, scientific or educational purposes (U. S. Fish and Wildlife Service, 1993). Disappearance from significant portions of its range are primarily due to changes in river and stream channels due to dams, dredging, or mining, and historic or episodic pollution events. The species is not known to survive in impounded waters and more than 1700 km of large and small river habitat in the Basin have been impounded by dams for navigation, flood control, water supply, and/or hydroelectric production purposes (FWS, 2004).

From USFWS (2000):
In the Mobile River basin, the greatest threats are dams (for navigation, water supply, electricity, recreation, and flood control), channelization (causing accelerated erosion, altered depth; and loss of habitat diversity, substrate stability, and riparian canopy), dredging (for navigation or gravel mining), mining (for coal, sand, gravel, or gold) in locally concentrated areas, pollution- point source (industrial waste effluent, sewage treatment plants, carpet and fabric mills, paper mills and refineries in mainstem rivers), pollution- nonpoint source (construction, agriculture, silviculture, urbanization).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species was listed as endangered in the U.S. under the federal Endangered Species Act in 1993, and is widely considered to be endangered throughout its range (Williams et al. 2008). It has also been assigned a NatureServe Global Heritage Status Rank of G2 - Imperilled (NatureServe 2009).

A specific recovery plan has been created for the Mobile River basin (USFWS 2000) which contains the following objectives: (1) protect habitat integrity and quality of river and stream segments that currently support or could support imperiled aquatic species, (2) consider options for free-flowing river and stream mitigation strategies that give high priority to avoidance and restoration, (3) promote voluntary stewardship as a practical and economical means of reducing nonpoint pollution from private land use, (4) encourage and support community-based watershed stewardship planning and action, (5) develop and implement programs and materials to educate the public on the need and benefits of ecosystem management, and to involve them in watershed stewardship, (6) conduct basic research on endemic aquatic species and apply the results toward management and protection of aquatic communities, (7) develop and implement technology for maintaining and propagating endemic species in captivity, (8) reintroduce aquatic species into restored habitats, as appropriate, (9) monitor listed species' population levels and distribution and periodically review ecosystem management strategy, (10) coordinate ecosystem management actions (USFWS 2000).

Critical habitat has been designated in Mississippi in the East Fork Tombigbee Rvier, Bull Mountain Creek, Buttahatchee River, and Luxapalila Creek; in Alabama in the Buttahatchee River, Luxapalila Creek, Coalfire Creek, Lubbub Creek, Sipsey River, Trussels Creek, Sucarnoochee River, Cahaba River, Alabama River, Bogue Chitto Creek, Uphapee complex, Coosa River, Hatchet Creek, Kelly Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (637 occuppied, 577 unoccuppied km) (USFWS 2004).

Chewacla Creek, Tallapoosa River Drainage, flows through the Tuskegee National Forest. This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia (Johnson et al. 2005). A flood control project on Luxapalila Creek, Mississippi, was modified by the Corps of Engineers to protect listed mussel habitat in that stream (USFWS 2000). Critical habitat has been designated in Mississippi in the East Fork Tombigbee River, Bull Mountain Creek, Buttahatchee River, and Luxapalila Creek; in Alabama in the Buttahatchee River, Luxapalila Creek, Coalfire Creek, Lubbub Creek, Sipsey River, Trussels Creek, Sucarnoochee River, Cahaba River, Alabama River, Bogue Chitto Creek, Uphapee complex, Coosa River, Hatchet Creek, Kelly Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (637 occupied, 577 unoccupied km) (USFWS 2004).

Williams et al. (1993) lists this species as Endangered according to the AFS assessment.

Continued research is needed into the species distribution, habitat and threats as part of a targeted monitoring scheme. Species recovery, protection (also for habitat) and legislation is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: 1. Conduct life history studies with an emphasis on fish host identification. 2. Perform genetic analysis comparing this species with Pleurobema chattanoogaensis and forms of the species which are recognized by the U. S. Fish and Wildlife Service as synonyms. These forms include Pleurobema crebrivittatus and Pleurobema pallidovulvus. 3. Determine if culturing of the species is a viable means of conservation. 4. Assess potential sites for reintroduction if culturing of the species proves successful.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Chewacla Creek, Tallapoosa River Drainage, flows through the Tuskegee National Forest. This species has been recently reported from the Conasauga River inside and adjacent to the Cherokee and Chattahoochee National Forests, Murray/Whitfield Co., Georgia (Johnson et al., 2005). A flood control project on Luxapalila Creek, Mississippi, was modified by the Corps of Engineers to protect listed mussel habitat in that stream (USFWS, 2000). Critical habitat has been designated in Mississippi in the East Fork Tombigbee Rvier, Bull Mountain Creek, Buttahatchee River, and Luxapalila Creek; in Alabama in the Buttahatchee River, Luxapalila Creek, Coalfire Creek, Lubbub Creek, Sipsey River, Trussels Creek, Sucarnoochee River, Cahaba River, Alabama River, Bogue Chitto Creek, Uphapee complex, Coosa River, Hatchet Creek, Kelly Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (637 occuppied, 577 unoccuppied km) (USFWS, 2004).

Needs: Critical habitat being proposed in 19 units across distribution in Mobile Basin (USFWS, 2004). Mobile River Basin recovery plan (USFWS, 2000) calls for: (1) use to fullest extent existing laws, regulations, and policies to portect listed populations and their habitats, and to develop and encourage a stream management strategy that places high priority on conservation; (2) encourage voluntary stewardship through joint initiatives and individual actions as the only practical and economical means of minimizing adverse effects of private land use and activities within watersheds; (3) continue to promote research efforts on life histories, sensitivities, and requirements of imperiled aquatic species, and develop technological capabilities to maintain and propagate them.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: This species was listed as federally endangered in the U.S. in 1993.

A specific recovery plan has been created for the Mobile River basin (USFWS, 2000) which contains the following objectives: (1) protect habitat integrity and quality of river and stream segments that currently support or could support imperiled aquatic species, (2) consider options for free-flowing river and stream mitigation strategies that give high priority to avoidance and restoration, (3) promote voluntary stewardship as a practical and economical means of reducing nonpoint pollution from private land use, (4) encourage and support community based watershed stewardship planning and action, (5) develop and implement programs and materials to educate the public on the need and benefits of ecosystem management, and to involve them in watershed stewardship, (6) conduct basic research on endemic aquatic species and apply the results toward management and protection of aquatic communities, (7) develop and implement technology for maintaining and propagating endemic species in captivity, (8) reintroduce aquatic species into restored habitats, as appropriate, (9) monitor listed species population levels and distribution and periodically review ecosystem management strategy, (10) coordinate ecosystem management actions (more detail in USFWS, 2000).

Critical habitat has been designated in Mississippi in the East Fork Tombigbee Rvier, Bull Mountain Creek, Buttahatchee River, and Luxapalila Creek; in Alabama in the Buttahatchee River, Luxapalila Creek, Coalfire Creek, Lubbub Creek, Sipsey River, Trussels Creek, Sucarnoochee River, Cahaba River, Alabama River, Bogue Chitto Creek, Uphapee complex, Coosa River, Hatchet Creek, Kelly Creek, Big Canoe Creek, and the lower Coosa River; in Georgia in Oostanaula complex; and in Tennessee in Oostanaula complex (637 occuppied, 577 unoccuppied km) (USFWS, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern clubshell

The southern clubshell, scientific name Pleurobema decisum, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States. Its natural habitat is rivers. It is threatened by habitat loss.

References

  1. ^ Bogan, A.E. 2000. Pleurobema decisum. 2006 IUCN Red List of Threatened Species. Downloaded on 7 August 2007.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Genetic analysis is needed to compare this species with Pleurobema chattanoogaensis and forms of the species (i.e., Pleurobema crebrivittatus and Pleurobema pallidovulvus) that are recognized by the U.S. Fish and Wildlife Service as synonyms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!