Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (100-250 square km (about 40-100 square miles)) Based on collection records, this species was endemic to the upper James River drainage (mainstem and tributaries including the Rivanna and North) above Richmond Virginia. Recent records of this species from the Dan River (a Roanoke River tributary) in Stokes Co., North Carolina (Savidge and Wood, 2001) corroborate historic stream capture between the headwaters of the Roanoke and James River systems in the mountains of Virginia (Johnson, 2006). It is currently restricted to a few small headwater tributaries in Virginia (Lipford, 1989) and West Virginia and in a few rivers (Tar River and Dan River) in North Carolina (Boss and Clench, 1967; Hove and Neves, 1991; Bogan, 2002; Savidge and Wood, 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (VA, WV)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Diagnostic Description

Aside from this species, only two other freshwater spined mussels are known: Elliptio spinosa, a large-shelled and long-spined species known from the Altamaha River system in Georgia, and Elliptio steinstansana, a species with intermediate shell size adn spine length found only in the Tar River in North Carolina (USFWS, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: This species is found in waters with slow to moderate current and relatively hard water on sand and mixed sand and gravel substrates (Boss and Clench, 1967).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: The distribution of this species is defined as occurring in five 'sub-drainages' (Hove and Neves, 1991; 1994), mostly in Virginia but extending slightly into West Virginia mostly in the upper watershed of the James River (Lipford, 1989) as well as the Dan and Mayo River drainages of the Roanoke River basin (Dan River) in North Carolina in Rockingham and Stokes Cos. (LeGrand et al., 2006; Savidge and Wood, 2001) plus the Tar River although originally thought to be in error (Boss and Clench, 1967; Bogan, 2002; Savidge and Wood, 2001; Johnson, 2006). In Virginia, a population was recently discovered (2000) in the Dan River and it was once widely distributed in the James River but is now reduced to about 10-15% of its former range there (VA NHP, pers. comm., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

This species is a short-term brooder that releases glochidia in summer (late May through early August). The following fish hosts are reported in Neves (1991) and Hove and Neves (1991; 1994): the rosyside dace (Clinostomus funduloides), bluehead chub (Nocomis leptocephalus), mountain redbelly dace (Phoxinus oreas), blacknose dace (Rhynichthys atratulus), central stoneroller (Campostoma anomalum), rosefin shiner (Lythrus ardens), satinfin shiner (Cyprinella analostana), and possibly the swallowtail shiner (Notropis procne).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema collina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTGGTTTGATTGGGTTGGCTTTGAGTCTTCTGATTCGGGCTGAGTTAGGGCAGCCAGGTAGGTTATTAGGGGAT---GACCAATTATATAATGTAATTGTAACGGCACATGCTTTTATAATAATTTTCTTTTTGGTGATGCCTATGATGATTGGTGGTTTTGGTAATTGGCTTATCCCCCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGGTTAAATAATTTGAGTTTTTGGTTACTTGTACCAGCTCTTTTTTTGTTATTAAGATCTTCTTTGGTAGAGAGAGGTGTTGGAACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATGTTGCTCATTCTGGGGCCTCAGTGGATTTAGCTATCTTTTCTTTACATCTTGCAGGTGCTTCTTCTATTTTGGGGGCTATTAATTTTATCTCTACTGTGGGGAATATGCGATCTCCAGGATTGGTTGCTGAGCGAATTCCTTTATTTGTGTGGGCTGTGACGGTAACAGCGGTTTTATTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCTATTACAATGTTGCTTACTGATCGTAATATTAATACATCTTTTTTTGATCCTGTTGGAGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema collina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: The range has been reduced to a few headwater tributaries in the Roanoke and James River basin (plus a new population in the Dan River) that are threatened by habitat degradation and competition from the Asian clam.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Restricted distribution hinders dispersal capabilities.

Environmental Specificity: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 07/22/1988
Lead Region:   Northeast Region (Region 5) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Pleurobema collina , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: This species may have experienced approximately a 90% reduction in range with survival documented in only a few creeks and small rivers in the upper James River drainage (USFWS, 1988; 1990).

Global Long Term Trend: Decline of 70 to >90%

Comments: Although it is likely that the decline of this species began with municipal growth and industrialization of cities and towns in the James River watershed, much of the decline has occurred in the last 20 years. It remained widespread through the mid-1960s but now apepars to be extirpated from approximately 90% of its historic range (USFWS, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Rapid decline in the past few decades is due to siltation, generated by agricultural and forestry activities such as road construction and gravel dredging; invasion of the Asiatic clam as a potential competitor; impoundments on rivers (more than 50 dams on Tennessee and Cumberland Rivers in Tennessee and Kentucky) and subsequent flood control and sedimentation and change in flow regime; pollution of inland waters from municipal, industrial, and agricultural sources (chlor-alkali plants, fly ash, sulfuric acid spills, acid mine drainage, organic wastes, insecticides) with several sewage treatment plants in and around the habitat of this species (USFWS, 1988; 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Biological Research Needs: Definitive negative interactions with the Asiatic clam need to be quantified. Life history details are active and ongoing through the efforts of Mark Hove and others.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Much of the best habitat is within the boundaries of the Jefferson or George Washington National Forests but these are not adequately protected.

Needs: Protection needs include protection and enhancement of habitat containing populations and establishing or expanding populations within rivers and river corridors which historically contained the species. Populations other than Craig and Johns Creeks need to be supplemented to reach viable size.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: This species was declared federally endangered in the U.S. in 1988 and a recovery plan was drafted (USFWS, 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

James River spinymussel

The James River spinymussel, scientific name Pleurobema collina, is a species of freshwater mussel in the family Unionidae, the river mussels. This species is native to Virginia and West Virginia in the United States.[1] It is a federally listed endangered species of the United States.

References

  1. ^ Pleurobema collina. The Nature Conservancy.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Davis and Fuller (1981) placed this species in the genus Fusconaia.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!