Overview

Distribution

Geographic Range

The clubshell was historically found in the Ohio, Cumberland and Tennessee River systems and Lake Erie drainages. Within these river systems it was found in the Wabash, Kanawha, Kentucky, Green, Monogahela and Alleghany Rivers. The range of P. clava has been greatly reduced.

In Michigan P. clava is restricted to the St. Joseph River (of the Maumee drainage) in Hillsdale County.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
  • Badra, P. 2001. Special animal abstract for Pleurobema clava (northern clubshell). Lansing, Michigan: Michigan Natural Features Inventory. Accessed October 10, 2005 at http://web4.msue.msu.edu/mnfi/abstracts/aquatics/Pleurobema_clava.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (1000-5000 square km (about 400-2000 square miles)) Historically, it was distributed across nine states in the Wabash, Ohio, Kanawha, Kentucky (Danglade, 1922; Clarke, 1987), Green, Monongahela, and Allegheny Rivers and their tributaries. It has been recorded from most of the tributaries in Kentucky, Illinois, Indiana, and Ohio, as well as from more isolated systems in Michigan, Pennsylvania, and West Virginia. Records from Nebraska, Minnesota, and Iowa (Simpson, 1900) ar eroneous (USFWS, 1994). Listed as occurring in the St. Peter's River in Minnesota and from Nebraska by Simpson (1914), however these records are probably in error. Somne records from the Cumberland River appear to be authentic, but others may represent Pleurobema oviforme (Gordon and Layzer, 1989). It is currently known from 12 streams in six states: Tippecanoe River in Indiana; Fish Creek in Ohio and Indiana; West Branch of the St. Josephs River in Ohio and Michigan; Walhonding River in Ohio; East Fork of the West Branch of the St. Josephs River in Michigan; Little Darby Creek in Madison County, Ohio; French Creek in Pennsylvania, in small numbers in the Green River in Kentucky, and the Elk River and Hackers Creek of the West Fork River in West Virginia (USFWS, 1994). It is extirpated from Alabama (Mirarchi et al., 2004), Illinois, Tennessee (U.S. Fish and Wildlife Service) and was recently thought to be extirpated from New York (Strayer and Jirka, 1997) but a population was recently rediscovered in the Allegheny River watershed (Smith and Horn, 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AL, IL, IN, KY, MI, OH, PA, TN, WV)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The northern clubshell is up to 7.6 cm (3 inches) long , and is triangular and elongate in shape. The shell is usually fairly thick, and compressed to moderately inflated. The   anterior end is rounded, the posterior end bluntly pointed. The dorsal margin is curved and slanted to the posterior end and the ventral margin is straight to slightly curved.

Umbos are low, being raised only slightly above the hinge line, and are situated at or near the anteriror end. The beak sculpture has concentric ridges at the tip of the umbo, and is not always visible.

The periostracum (outer shell layer) is yellow-brown with prominent broken green rays. Older specimens tend to be more brown or black.

On the inner shell, the   left valve has two   pseudocardinal teeth, which are small, triangular, serrated and erect. The two lateral teeth are straight to slightly curved, thin, and moderately long. The right valve has one large, erect triangular serrated pseudocardinal tooth and one lateral tooth that is also straight to slightly curved, thin and moderately long.

The beak cavity is shallow to moderately deep. The nacre is white and iridescent at the posterior end.

In Michigan, this species can be confused with the ellipse or the Wabash pigtoe. The ellipse is more compressed and has a more broadly rounded anterior end. The Wabash pigtoe lacks green rays and is also not as wedge-shaped as the clubshell.

Range length: 7.6 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 9 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Despite shell variation there should be no difficulty in identifying this species. Superficially similar species such as P. DECISUM and P. CHATTANOOGAENSE are more southern in distribution. The fragile posterior portion of the shell is usually broken away in all but the freshest specimens, but the small size and anteriorly placed umbos are usually sufficient for identification.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleurobema clava is found in streams and small rivers, in well oxygenated riffles with coarse sand and gravel and little silt. In Michigan, runs where it was found had water currents of 0.06-0.25 meters per second.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Despite the type locality of Lake Erie (apparently in error), this is a species of small to medium-sized rivers and streams. Ortmann (1919) remarked that it was "a rare shell, and never found in great numbers. It is found mostly in sand and fine gravel, and is deeply buried." Hoggarth (pers. comm.) and Watters (unpublished) have found live individuals completely buried with the posterior shell margin facing up in sand/gravel substrate in riffle/run situations in less than 1.5 feet of water. This seems to be the habitat of choice. Because it buries itself beneath the substrate, it is rarely found alive even in places where it is believed to occur in some numbers. Although now considered a creek or small river species, many records from larger rivers such as the Wabash and Tennessee show that this is a recent misconception. This species is generally found in clean, coarse sand and gravel in runs, often just downstream of a riffle, and cannot tolerate mud or slackwater conditions (USFWS, 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

In lab trials, Pleurobema clava glochidia metamorphosed on the central stoneroller, striped shiner, logperch and blackside darter.

Ecosystem Impact: parasite

Species Used as Host:

  • O'Dee, S., G. Watters. 2000. New or confirmed host identifications for ten freshwater mussels. Freshwater Mollusk Symposium Proceedings: 77-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

Unknown

Comments: Due to problems obtaining a unbiased and complete sample, abundance in mussels is always difficult to estimate. Few detailed abundance estimates have been done on this species. Surveys in 1992 and 1993 of the Tippecanoe River in Indiana found living individuals at nine sites from the mouth upstream 150 miles. Fresh dead individuals were found at another 10 sites with weathered shells at 97% of sites studied. It was also found as weathered shells at 8 sites and fresh dead at another site in the Mississinewa River in Indiana in 1994 as well as weathered shells from two sites in Indiana's Salamonie River (USFWS, 1994). Smith and Crabtree (2010) found this species at 2 of 32 sites (1 with recruitment) along the entire length of Pennsylvania's French Creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Known from short reaches of 12 streams (USFWS, 1993; 1994) including small populations in the headwater tributaries of the St. Joseph River (Indiana/Ohio) (Grabarkiewicz and Crail, 2006). It is known from the St. Joseph and Maumee (Pror, 2005) and Tippecanoe Rivers, Indiana (Cummings and Berlocher, 1990; Fisher, 2006). Weathered shells are known from Sugar Creek (east fork White River drainage) in central Indiana (Harmon, 1992). A single specimen was collected from the Middle Branch of the North Fork Vermillion River in Illinois (Szafoni et al., 2000). More recently, this species was found in 5 sites (4 with living specimen) in Pymatuning Creek in Ashtabula County, Ohio (Huehner and Corr, 1994). Matter et al. (2006) failed to find this species in surveys of Ohio Brush Creek, Ohio, despite reports of a weathered specimen in 1987 (Watters, 1992) indicating it may be extirpated from that locale. Populations in Ohio are also known from the Walhonding River (OH NHP, pers. comm., 2006). Recently this species was rediscovered in Cassadaga Creek in the Allegheny River watershed in New York (Smith and Horn, 2006). In Pennsylvania it is extant in the Shenango drainage (Bursey, 1987); French (Mohler et al., 2006) and Middle Allegheny-Redbank drainages (PA NHP, pers. comm., 2006) and historical in the Conemaugh, Connoquenessing, Kiskiminetas, Mahoning, and Lower Monongahela drainages (Ortmann, 1919). A few sites are known in northwestern drainages in West Virginia (WV NHP, pers. comm., 2007) possibly in the Ohio and Kanawha Rivers (Taylor and Horn, 1983). In Kentucky it is rare in the upper Green River (Cicerello and Schuster, 2003) including Rough River (Gordon, 1991) and may still be holding on in the lower Ohio (Blue-Sinking section) (KY NHP, pers. comm., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Virtually nothing is known specifically for Clava. Refer to the General Freshwater Mussel ESA for more information on the general biology-ecology of mussels.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. How the clubshell recognizes and/or attracts its fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The clubshell can live up to 50 years.

Range lifespan

Status: wild:
50 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Pleurobema clava is a short-term brooder. Gravidity has not been recorded, so general spawning time is unknown.

Breeding interval: The clubshell breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is unknown.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Virtually nothing is known specifically for Pleurobema clava. Ortmann (1919) reported that it bred from mid-May to late July.

Based upon counts of annular growth lines, Pleurobema clava may reach 30+ years of age. It is not known at what ages reproductive maturity begins and ends. Because of the rarity of live material, it is not known if existing populations are reproductively active. Because of their small size, it is not known if juveniles are present in any of the populations. It must be emphasized that existing populations may be large, healthy, and reproductively active and still be in imminent danger of extinction if the host fish is not present in the range. Laboratory studies by Watters and O'Dee (1997)and O'Dee and Watters (2000) identified the striped shiner (Luxilus chrysocephalus), blackside darter (Percina maculata), central stoneroller (Campostoma anomalum) and logperch (Perca caprodes) as potential fish hosts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema clava

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTATTGCTGGCTTTATGATCTGGTTTGATTGGGTTGGCTTTAAGCCTTCTAATTCGAGCTGAGCTAGGGCAGCCTGGTAGGTTGTTGGGGGAT---GATCAATTATATAATGTGATTGTGACAGCGCACGCTTTTATAATAATNTNNTTCTTGGTGATACCTATGATGATTGGGGGTTTTGGTAATTGGCTTATTCCTCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGGTTACTTGTGCCTGCTTTATTTTTGTTGTTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGAACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGGGCCTCGGTAGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTGGGGAATATACGATCTCCTGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTGTGGGCTGTGACAGTAACGGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCCATTACGATGTTGCTTACTGATCGTAACATTAATACGTCTTTTTTTGATCCTGTTGGGGGGGGTGACCCG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema clava

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 01/22/1993
Lead Region:   Northeast Region (Region 5)   
Where Listed: Entire Range; Except where listed as Experimental Populations

Status: Experimental Population, Non-Essential
Date Listed: 06/14/2001
Lead Region:   Southeast Region (Region 4)   
Where Listed: AL; Free-Flowing Reach of the Tennessee River below the Wilson Dam, Colbert and Lauderdale Counties, AL


Population detail:

Population location: Entire Range; Except where listed as Experimental Populations
Listing status: E

Population location: U.S.A. (AL;The free-flowing reach of the Tennessee R. from the base of Wilson Dam downstream to the backwaters of Pickwick Reservoir [about 12 RM (19 km)] and the lower 5 RM [8 km] of all tributaries to this reach in Colbert and Lauderdale Cos., see 17.85(a))
Listing status: EXPN

For most current information and documents related to the conservation status and management of Pleurobema clava , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pleurobema clava is a federally Endangered species in the United States. The IUCN Red List considers this species Critically Endangered. The range of the clubshell has probably been reduced about 95% and this species is likely sensitive to siltation.

US Federal List: endangered

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: This species has been extirpated from most of its range in this century (probably less than 20% of historical range remains). Continued loss of habitat and water quality deterioration threaten remaining populations.

Intrinsic Vulnerability: Unknown

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Comments: This species is generally found in clean, coarse sand and gravel in runs, often just downstream of a riffle, and cannot tolerate mud or slackwater conditions (USFWS, 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 70 to >90%

Comments: The U.S. Fish and Wildlife Service (1993) estimate at least a 95% reduction in range as this species was much more widespread historically. For example, it was formerly widely distributed in the Vermillion and Wabash River drainages in Illinois and Ohio (Clarke, 1987) but is now extirpated from the state of Illinois (Cummings and Mayer, 1997) except for the North Fork Vermillion River (Szafoni et al., 2000) and was also formerly distributed in the lower Tennessee River and Cumberland River in Tennessee, but it is also likely extirpated in that state (Parmalee and Bogan, 1998). Much of its former range in south central Ohio has been reduced or eliminated (Watters, 1992) including the Scioto River, near Chillicothe, Ohio (as P. bournianum- Watters, 1995; Watters et al., 2009) where it has not been seen in over 150 years. It is nearly extirpated from New York (Strayer and Jirka, 1997).

Global Long Term Trend: Decline of 70-90%

Comments: In Pennsylvania it is extant in the Shenango drainage (Bursey, 1987); French and Middle Allegheny-Redbank drainages (PA NHP, pers. comm., 2006) and historical in the Conemaugh, Connoquenessing, Kiskiminetas, Mahoning, and Lower Monongahela drainages (Ortmann, 1919). In Alabama it occurred in the Tennessee River across the northern part of the state but si now extirpated with the most recent known collections of live individuals in tailwaters of Wilson Dam in 1966 (Williams et al., 2008). It is extirpated from the McAlpine dam pool in the Ohio River at Louisville, Kentucky (and Indiana) (Watters and Flaute, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: This species is threatened by domestic and industrial waste and navigation developments in the upper Ohio and Wabash river watersheds. Stansbery (pers. comm.) believed that various pesticides were at least partially responsible for the overall decrease in the fauna of areas in which Pleurobema clava was present. Proposed coal mining in the Elk River watershed may threaten that population. The introduced zebra mussel could also pose a significant threat. The species is particularly vulnerable to siltation, which clogs the substrate interstices and suffocates the animal. USFWS (1994) lists the following reasons for decline: siltation (from agriculture, construction, and forestry runoff), impoundment (including dam constructon and maintenance), instream sand and gravel mining (for channelization), pollutants (pesticides and fertilizers, heavy metals, ammonia from wastewater, acid-mine runoff, and invasive species (zebra mussel, quagga mussel).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: The original range includes waterfront on such cities as Indianapolis, Toledo, Cincinnati, Columbus, Charleston, and Pittsburg. It is doubtful that the range of Clava can ever be recovered based upon the present water quality of the rivers serving these cities. At this time the reasons for the extirpation of Clava from most of its range are unknown; this reduces any conservation plans to save it to mere guesswork.

Preserve Selection and Design Considerations: Refer to the General Freshwater Mussel ESA.

Management Requirements: Refer to the General Freshwater Mussel ESA.

Management Research Needs: Refer to the General Freshwater Mussel ESA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Nonessessential Experimental Populations (NEPs) have been established in the Tennessee River below Wilson Dam, Colbert and Lauderdale Cos., Alabama, extending13.4 km and including the lower 8 km of all tributaries that enter the Wilson Dam tailwaters (USFWS, 2001). This species occurs in Muddy Creek (French Creek drainage) in the Erie NWR in Crawford Co., Pennsylvania (Mohler et al., 2006).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: This subspecies was listed as federally endangered in the U.S. in 1993 and a recovery plan created (USFWS, 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Club naiad

The club naiad, clubshell pearly mussel, or clubshell, scientific name Pleurobema clava, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The relationship between Pleurobema oviforme and Pleurobema clava is a matter of debate as P. oviforme replaces P. clava in headwaters of the Tennessee River, and it has been suggested that they are conspecific (Williams et al., 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!