Overview

Distribution

Geographic Range

The clubshell was historically found in the Ohio, Cumberland and Tennessee River systems and Lake Erie drainages. Within these river systems it was found in the Wabash, Kanawha, Kentucky, Green, Monogahela and Alleghany Rivers. The range of P. clava has been greatly reduced.

In Michigan P. clava is restricted to the St. Joseph River (of the Maumee drainage) in Hillsdale County.

Biogeographic Regions: nearctic (Native )

  • Burch, J. 1975. Freshwater unionacean clams (Mollusca: Pelecypoda) of North America. Hamburg, Michigan: Malacological Publications.
  • Badra, P. 2001. Special animal abstract for Pleurobema clava (northern clubshell). Lansing, Michigan: Michigan Natural Features Inventory. Accessed October 10, 2005 at http://web4.msue.msu.edu/mnfi/abstracts/aquatics/Pleurobema_clava.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
U.S.A. (AL, IL, IN, KY, MI, OH, PA, TN, WV)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The northern clubshell is up to 7.6 cm (3 inches) long , and is triangular and elongate in shape. The shell is usually fairly thick, and compressed to moderately inflated. The   anterior end is rounded, the posterior end bluntly pointed. The dorsal margin is curved and slanted to the posterior end and the ventral margin is straight to slightly curved.

Umbos are low, being raised only slightly above the hinge line, and are situated at or near the anteriror end. The beak sculpture has concentric ridges at the tip of the umbo, and is not always visible.

The periostracum (outer shell layer) is yellow-brown with prominent broken green rays. Older specimens tend to be more brown or black.

On the inner shell, the   left valve has two   pseudocardinal teeth, which are small, triangular, serrated and erect. The two lateral teeth are straight to slightly curved, thin, and moderately long. The right valve has one large, erect triangular serrated pseudocardinal tooth and one lateral tooth that is also straight to slightly curved, thin and moderately long.

The beak cavity is shallow to moderately deep. The nacre is white and iridescent at the posterior end.

In Michigan, this species can be confused with the ellipse or the Wabash pigtoe. The ellipse is more compressed and has a more broadly rounded anterior end. The Wabash pigtoe lacks green rays and is also not as wedge-shaped as the clubshell.

Range length: 7.6 (high) cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pleurobema clava is found in streams and small rivers, in well oxygenated riffles with coarse sand and gravel and little silt. In Michigan, runs where it was found had water currents of 0.06-0.25 meters per second.

Habitat Regions: freshwater

Aquatic Biomes: rivers and streams

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

In general, unionids are filter feeders. The mussels use cilia to pump water into the   incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the   labial palps and then directed to the mouth. Mussels have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles.

The parasitic glochidial stage absorbs blood and nutrients from hosts after attachment. Mantle cells within the glochidia feed off of the host’s tissue through phagocytocis.

Plant Foods: algae; phytoplankton

Other Foods: detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore ; detritivore

  • Meglitsch, P., F. Schram. 1991. Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Fish hosts are determined by looking at both lab metamorphosis and natural infestations. Looking at both is necessary, as lab transformations from glochidia to juvenile may occur, but the mussel may not actually infect a particular species in a natural situation. Natural infestations may also be found, but glochidia will attach to almost any fish, including those that are not suitable hosts. Lab transformations involve isolating one particular fish species and introducing glochidia either into the fish tank or directly inoculating the fish gills with glochidia. Tanks are monitored and if juveniles are later found the fish species is considered a suitable host.

In lab trials, Pleurobema clava glochidia metamorphosed on the central stoneroller, striped shiner, logperch and blackside darter.

Ecosystem Impact: parasite

Species Used as Host:

  • O'Dee, S., G. Watters. 2000. New or confirmed host identifications for ten freshwater mussels. Freshwater Mollusk Symposium Proceedings: 77-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Unionids in general are preyed upon by muskrats, raccoons, minks, otters, and some birds. Juveniles are probably also fed upon by freshwater drum, sheepshead, lake sturgeon, spotted suckers, redhorses, and pumpkinseeds.

Unionid mortality and reproduction is affected by unionicolid mites and monogenic trematodes feeding on gill and mantle tissue. Parasitic chironomid larvae may destroy up to half the mussel gill.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The middle lobe of the mantle edge has most of a bivalve's sensory organs. Paired   statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity) are in the mussel's foot. The statocysts help the mussel with georeception, or orientation.

Mussels are heterothermic, and therefore are sensitive and responsive to temperature.

Unionids in general may have some form of chemical reception to recognize fish hosts. How the clubshell recognizes and/or attracts its fish host is unknown.

Glochidia respond to touch, light and some chemical cues. In general, when touched or a fluid is introduced, they will respond by clamping shut.

Communication Channels: chemical

Perception Channels: visual ; tactile ; vibrations ; chemical

  • Brusca, R., G. Brusca. 2003. Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

Fertilized eggs are brooded in the marsupia (water tubes) up to 11 months, where they develop into larvae, called glochidia. The glochidia are then released into the water where they must attach to the gill filaments and/or general body surface of the host fish. After attachment, epithelial tissue from the host fish grows over and encapsulates a glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults.

Development - Life Cycle: metamorphosis

  • Arey, L. 1921. An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33: 463-499.
  • Lefevre, G., W. Curtis. 1910. Reproduction and parasitism in the Unionidae. J. Expt. Biol., 9: 79-115.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The clubshell can live up to 50 years.

Range lifespan

Status: wild:
50 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Age to sexual maturity for this species is unknown. Unionids are gonochoristic (sexes are separate) and viviparous. The glochidia, which are the larval stage of the mussels, are released live from the female after they are fully developed.

In general, gametogenesis in unionids is initiated by increasing water temperatures. The general   life cycle of a unionid, includes open fertilization. Males release sperm into the water, which is taken in by the females through their respiratory current. The eggs are internally fertilized in the suprabranchial chambers, then pass into water tubes of the gills, where they develop into glochidia.

Pleurobema clava is a short-term brooder. Gravidity has not been recorded, so general spawning time is unknown.

Breeding interval: The clubshell breeds once in the warmer months of the year.

Breeding season: In Michigan, the breeding season is unknown.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Females brood fertilized eggs in their marsupial pouch. The fertilized eggs develop into glochidia. There is no parental investment after the female releases the glochidia.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Watters, G. 1995. A guide to the freshwater mussels of Ohio. Columbus, Ohio: Ohio Department of Natural Resources.
  • Lefevre, G., W. Curtis. 1912. Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28: 617-626.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema clava

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TATTTATTGCTGGCTTTATGATCTGGTTTGATTGGGTTGGCTTTAAGCCTTCTAATTCGAGCTGAGCTAGGGCAGCCTGGTAGGTTGTTGGGGGAT---GATCAATTATATAATGTGATTGTGACAGCGCACGCTTTTATAATAATNTNNTTCTTGGTGATACCTATGATGATTGGGGGTTTTGGTAATTGGCTTATTCCTCTTATGATTGGGGCTCCTGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGGTTACTTGTGCCTGCTTTATTTTTGTTGTTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGAACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGGGCCTCGGTAGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATTTCTACTGTGGGGAATATACGATCTCCTGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTGTGGGCTGTGACAGTAACGGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTAGCTGGTGCCATTACGATGTTGCTTACTGATCGTAACATTAATACGTCTTTTTTTGATCCTGTTGGGGGGGGTGACCCG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema clava

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Bogan, A.E.

Reviewer/s

Contributor/s

History
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Indeterminate
    (IUCN 1990)
  • 1988
    Indeterminate
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Indeterminate
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 01/22/1993
Lead Region:   Northeast Region (Region 5)   
Where Listed: Entire Range; Except where listed as Experimental Populations

Status: Experimental Population, Non-Essential
Date Listed: 06/14/2001
Lead Region:   Southeast Region (Region 4)   
Where Listed: AL; Free-Flowing Reach of the Tennessee River below the Wilson Dam, Colbert and Lauderdale Counties, AL


Population detail:

Population location: Entire Range; Except where listed as Experimental Populations
Listing status: E

Population location: U.S.A. (AL;The free-flowing reach of the Tennessee R. from the base of Wilson Dam downstream to the backwaters of Pickwick Reservoir [about 12 RM (19 km)] and the lower 5 RM [8 km] of all tributaries to this reach in Colbert and Lauderdale Cos., see 17.85(a))
Listing status: EXPN

For most current information and documents related to the conservation status and management of Pleurobema clava , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pleurobema clava is a federally Endangered species in the United States. The IUCN Red List considers this species Critically Endangered. The range of the clubshell has probably been reduced about 95% and this species is likely sensitive to siltation.

US Federal List: endangered

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no significant negative impacts of mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mussels are ecological indicators. Their presence in a water body usually indicates good water quality.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Club naiad

The club naiad, clubshell pearly mussel, or clubshell, scientific name Pleurobema clava, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!