Overview

Distribution

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (<100-250 square km (less than about 40-100 square miles)) It was historically found in the Conasauga River in Tennessee and Georgia, in the Chatooga, Coosa, and Oostanaula rivers and Armuchee Creek in Georgia, and throught the length of the Coosa River in Alabama (USFWS, 1999; 2003). In the Coosa River basin in Georgia, it is known historically from the Coosa, Etowah, Oostanaula, and Conasauga River drainages but has not been collected there recently (Williams and Hughes, 1998). Recently fresh dead shells were collected in the upper Conasauga River during a 1997 survey (Williams and Hughes, 1998). Thought to persist in Alabama only in Weiss bypass of Coosa River, Cherokee County (Mirarchi et al., 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: In the Conasauga River it inhabits riffle areas with substrates of coarse sand and gravel.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Recent collections yielded a few shells from localized portions of one river. There exist recent collections of a few live and fresh dead shells of each species from localized portions of the upper Conasauga River in Murray and Whitfield counties, Georgia (USFWS, 2003). It is questionable as to whether it still exists in the Conasauga River in Tennessee (Parmalee and Bogan, 1998). It is thought to persist in Alabama only in Weiss bypass of Coosa River, Cherokee County (Mirarchi et al., 2004) as it was formerly thought extirpated from that state.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

The glochidial host is not known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pleurobema chattanoogaense

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCTTTATGATCTGGTTTGATTGGGTTGGCTTTGAGTCTTTTGATTCGGGCTGAGCTAGGGCAACCTGGTAGGTTGTTGGGAGAT---GATCAATTGTATAATGTGATTGTGACAGCGCATGCTTTTATAATAATTTTCTTCTTGGTGATACCTATGATGATTGGGGGTTTTGGAAATTGGCTTATTCCTCTTATGATTGGGGCTCCCGATATGGCTTTTCCTCGATTAAATAATTTAAGGTTTTGGTTACTTGTGCCTGCTCTCTTTTTGTTATTGAGGTCTTCTTTGGTGGAGAGGGGTGTTGGGACTGGTTGGACGGTTTATCCGCCTTTGTCTGGGAATATTGCTCATTCTGGAGCTTCAGTGGATTTGGCTATTTTTTCTTTGCATCTTGCTGGTGCATCTTCTATTTTGGGGGCTATTAATTTTATCTCCACTGTGGGGAATATACGATCTCCTGGGTTGGTTGCTGAGCGAATTCCTTTATTCGTATGGGCTGTGACGGTAACAGCGGTTTTGTTGGTTGCTGCGTTGCCTGTTTTGGCTGGTGCTATTACGATGTTGCTTACTGATCGTAATATTAATACATCTTTTTTTGATCCTGTTGGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pleurobema chattanoogaense

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: A collection of recently dead shells in 1997 increase the likelihood that this species is still extant, at least in one stretch of the Conasauga River only. Otherwise it is in imminent danger of extinction, however there are severe questions as to its taxonomic authenticity.

Intrinsic Vulnerability: Highly vulnerable

Comments: Threats are compounded by their restricted range and low numbers. The species is vulnerable to random catastrophic events (e.g., flood scour, drought, toxic spills, etc.). Limited range and low numbers also make the species vulnerable to land use changes within the Conasauga River watershed that would result in increases in non-point source pollution impacts (USFWS, 2003).

Environmental Specificity: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A1ce+2ce

Version
2.3

Year Assessed
2000
  • Needs updating

Assessor/s
Bogan, A.E. (Mollusc Specialist Group)

Reviewer/s
Seddon, M.B. (Mollusc Red List Authority)

Contributor/s

Justification
Bogan suggests that this species is possibly extinct and it is listed by others as extinct. Listed here as Critically Endangered due to lack of survey information and some rumours of possible specimens.

History
  • 1996
    Critically Endangered
    (Baillie and Groombridge 1996)
  • 1996
    Critically Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 50-70%

Comments: Once a common species in stretches of the Conasauga River in Tennessee and northern Georgia; now few if any populations remain (Parmalee and Bogan, 1998). It is thought to be extirpated from over 90 percent of its historic range (USFWS, 1999). In 1990, the U.S. Fish and Wildlife Service initiated a status survey and review of the molluscan fauna of the Mobile River Basin reported 14 species of mussels in the genus Pleurobema, including the painted clubshell, Georgia pigtoe, and Alabama clubshell, as presumed extinct in the Mobile River Basin, based on their absence from collection records, technical reports, or museum collections for a period of 20 years or more (USFWS, 1994). Recently fresh dead shells were collected in the upper Conasauga River during a 1997 survey (Williams and Hughes, 1998).

Global Long Term Trend: Decline of 70 to >90%

Comments: Pleurobema chattanoogaense has been extirpated from well over 90 percent of their historic range. This species is currently known from isolated populations surviving in localized portions of a short reach of the Conasauga River above Dalton, Georgia, and a short reach of the Coosa River in Cherokee Co., Alabama (USFWS, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Very high - high

Comments: Causes of the decline can be attributed to extensive impoundment of the Coosa River and its primary tributaries, and the effects of point and non-point source pollution on the surviving isolated populations. Isolated populations are vulnerable to land surface runoff that affects water quality or the suitability of aquatic habitats within a watershed. Blocked from avenues of emigration to less affected watersheds, they gradually perish if changes in land use activities cause aquatic habitat conditions to deteriorate. While the detrimental effect of any one source or land use activity may be insignificant by itself, the combined effects of land use runoff within a watershed may result in gradual and cumulative adverse impacts to isolated populations and their habitats. Excessive nutrient input from multiple sources (e.g, nitrogen and phosphorus from fertilizer, sewage waste, animal manure, etc.) into an aquatic system can also have negative cumulative effects (USFWS, 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: None. No occurrences appropriately protected and managed

Comments: All riparian lands are in corporate or private ownership.

Needs: The Service is working to establish a National Wildlife Refuge in the upper Conasauga River. Watershed management outreach has been conducted. The Nature Conservancy has conducted a watershed impact analysis for the Conasauga River watershed. Surveys are ongoing, and genetic studies will be continuing to clarify and confirm taxonomy of this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Painted clubshell

The painted clubshell, scientific name Pleurobema chattanoogaense, is a species of freshwater mussel, an aquatic bivalve mollusk in the family Unionidae, the river mussels.

This species is endemic to the United States. Its natural habitat is rivers.

Source

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some researchers consider this a distinct species, others consider it a junior synonym of Pleurobema hanleyanum or Pleurobema decisum. Williams et al. (2008) tentatively consider it a synonym of Pleurobema decisum but note preliminary genetic analysis was inconclusive. The taxonomy of this species as a specific entity is questionable.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!