Overview

Brief Summary

Biology

Capable of living for up to an incredible 200 years old (7), the freshwater pearl mussel begins life as a tiny larva, measuring just 0.6 to 0.7 millimetres long, which is ejected into the water from an adult mussel in a mass of one to four million other larvae. This remarkable event takes place over just one to two days, sometime between July and September (2). The larvae, known as glochidia, resemble tiny mussels, but their minute shells are held open until they snap shut on a suitable host. The host of freshwater pearl mussel larvae are fish from the salmonid family, which includes the Atlantic salmon and sea trout (2). The chances of a larva encountering a suitable fish is very low (6), and thus nearly all are swept away and die; only a few are inhaled by an Atlantic salmon or sea trout, where they snap shut onto the fish's gills (2). Attached to the gills of a fish, the glochidia live and grow in this oxygen-rich environment until the following May or June, when they drop off. The juvenile must land on clean gravely or sandy substrates if it is to successfully grow (2). Attached to the substrate, juvenile freshwater pearl mussels typically burrow themselves completely into the sand or gravel, while adults are generally found with a third of their shell exposed (2). Should they become dislodged, freshwater pearl mussels can rebury themselves, and are also capable of moving slowly across sandy sediments, using their large, muscular foot (2). The freshwater pearl mussel grows extremely slowly (6), inhaling water through exposed siphons, and filtering out tiny organic particles on which it feeds (2). It is thought that in areas where this species was once abundant, this filter feeding acted to clarify the water, benefiting other species which inhabited the rivers and streams (2). Maturity is reached at an age of 10 to 15 years (2), followed by a reproductive period of over 75 years in which about 200 million larvae can be produced (6). In early summer each year, around June and July, male freshwater pearl mussels release sperm into the water, where it is inhaled by female mussels. Inside the female, the fertilised eggs develop in a pouch on the gills for several weeks, until temperature or other environmental cue triggers the female to release the larvae into the surrounding water (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

One of the longest-living invertebrates in existence (2), the freshwater pearl mussel has, like all bivalve molluscs, a shell consisting of two parts that are hinged together, which can be closed to protect the animal's soft body within (3). The shell is large, heavy and elongated (4) (5), typically yellowish-brown in colour when young and becoming darker with age (2). Older parts of the shell often appear corroded, an identifying feature of this mussel species (6). The inner surface of the shell is pearl white, sometimes tinged with attractive iridescent colours (4). Like all molluscs, the freshwater pearl mussel has a muscular 'foot' (3); this very large, white foot enables the mussel to move slowly and bury itself within the bottom substrate of its freshwater habitat (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) This species has a circumboreal distribution in northern Europe, eastern North America, and Eurasia. Its range includes the arctic and temperate regions of western Russia, westwards through Europe to the north-eastern seaboard of North America and southwards to the Iberian peninsula and "central" Europe. In North America it is distributed from Newfoundland and Labrador down to Pennsylvania (Burch, 1975) and Delaware and west to the Appalachian mountains (Ziuganov et al., 1994). The eastern pearlshell is widespread in New England and the Canadian Maritime Provinces (Nedeau et al., 2000; Clarke, 1981; Smith, 2000; Fichtel and Smith, 1995; Raithel and Hartenstein, 2006). The current status across its range is as follows: USA- declining and of special concern but somewhat stable in New England, Canada- some large populations remain and threats are few, Portugal- presumed extinct, Spain- serious decline with one or two functional populations including recently in the Iberian Peninsula (Velasco et al., 2006), France- still present but scarce in most of its former range, Belgium- extirpated, Germany- still present but serious decline although some functional populations in Bavaria, Austria- serious decline with 1-2 functional populations, Czech Republic- serious decline with one functional population, Norway- serious decline especially in the south, Denmark- extirpated, Sweden- serious decline with appreciable recruitment at only two sites, Finland- 75% populations lost with ca 8 functional populations, Russia- serious decline with four populations of over 1 million remaining, Eire- serious decline with little recruitment, England- only one common population remaining with limited recruitment, Wales- only one population above 3000 individuals and very few juveniles, Northern Ireland- 90% population lost and almost no recruitment, Scotland- serious decline with ca 10 fully functional populations (Young et al., 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Margaritifera margaritifera, also known as the freshwater pearl mussel or the eastern pearlshell, is native to European rivers and streams. The range stretches from Norway to Spain and populations are found in Great Britain and Scotland. This species has also been introduced to North America, where sizable populations are found in the northeastern United States and eastern Canadian coast.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The freshwater pearl mussel can be found on both sides of the Atlantic (4), from the Arctic and temperate regions of western Russia, through Europe to north-eastern North America (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

As bivalve mollusks, freshwater pearl mussels have hard shells consisting of two plates attached to a hinge. The color and thickness of the shell changes over time. Juveniles have thin shells that are yellowish-brown, whereas adults have thicker shells that are dark, glossy black. All freshwater pearl mussels, regardless of age, are roughly kidney-shaped and have an appendage on the base of their shell called a foot. The foot allows them to burrow into yielding ground, move slowly about on sandy soil, and anchor themselves in place. They also have a siphon to draw in water, gills to filter out edible material, and a second siphon to expel filtered water.

Male, female, and hermaphroditic freshwater pearl mussels are identical in appearance. Different sexes have the same coloration and, given equal amounts of food, grow at the same rate. It is therefore impossible to discover the sex of organisms without dissecting them.

Freshwater pearl mussels typically grow to 10 to 13 cm in length, although there will be a large amount of variability in size in a healthy population. A particularly large specimen was over 17 cm long, newborn freshwater pearl mussels may be smaller than 1 cm long.

Range length: 17.6 (high) cm.

Average length: 11.5 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Generally live buried in clean, mixed stable substrate in fast-flowing unpolluted streams and rivers , but an unusual reproductively viable population in Shetland, Scotland, found recently (Cosgrove and Harvey, 2003) in a fen habitat in peat substrate is atypical.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater pearl mussels live buried or partly buried in stream bed substrates that have sandy patches surrounded by boulders and large rocks. They favor riffles, common sites for heavy sedimentation. Areas of fast-flowing water low in nitrates and phosphates and shaded by riparian growth are preferred due to the lower likelihood of algal blooms.

Juvenile freshwater pearl mussels are more vulnerable to fluctuation in environmental conditions than adults and have stricter requirements for survival as a result. While adults can temporarily tolerate muddy or silty conditions, juveniles cannot survive in those habitats. They must settle in sandy habitats interspersed with rocks and boulders. They require clear water not saturated with small sediment particles that interfere with their ability to feed. Water that is 0.3 to 0.4 meters deep and flowing at a rate of 0.25 to 0.75 meters per second is also necessary for these mussels to feed properly. The pH of the water must be under 7.5 in order to support juvenile populations.

Range depth: 0.3 to 0.4 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: benthic ; rivers and streams

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clean, fast-flowing streams and rivers are required for the freshwater pearl mussel (4) (2), where it lives buried or partly buried in fine gravel and coarse sand (2), generally at depths between 0.5 and 2 metres, but sometimes at greater depths (4). Clean gravel and sand is essential, particularly for juvenile freshwater pearl mussels, as if the stream or river bottom becomes clogged with silt, they can not obtain oxygen and will die (4). Also essential is the presence of a healthy population of salmonids, a group of fish including salmon and trout, on which the freshwater pearl mussel relies for part of its life cycle (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Freshwater pearl mussels filter small organic particles from the water column. It is not known exactly what they eat, but the organism's diet likely consists of fungal spores, bacteria, tiny phyloplankton and zooplankton, and other very small filterable particles.

Algal blooms can interfere with a freshwater pearl mussel's ability to filter food from the water. Populations of zebra mussels and other bivalves can also lead to competition for food, as both groups filter for similar food material.

Animal Foods: zooplankton

Plant Foods: phytoplankton

Other Foods: fungus; detritus ; microbes

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

It has been suggested that freshwater pearl mussels help to keep water clean, although their environmental impact on water quality is not fully understood. However, an average sized adult freshwater pearl mussel can filter 50 L of water each day, and they also excrete waste products that are broken down by detritus-eating organisms. Those waste products contain important nutrients for plant life. Fish in general, particularly fish in the genera Oncorhynchus and Salmo are important hosts for these mussels. This commensal relationship does not harm the fish hosts.

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Juvenile freshwater pearl mussels are eaten by crayfish, eels, and North American muskrats (Ondatra zibethicus). Adult freshwater pearl mussels do not appear to have any predators. Their thicker shells and larger size protect them from organisms that typically eat juveniles.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: In Rhode Island, this species occurs primarily in headwater streams of the Pawcatuck River basin and a few sites in the Blackstone River and Pawtuxet River basins although these latter two basin populations may now be extirpated (Raithel and Hartenstein, 2006). In Maine, it is known from nearly every watershed in every county except the Sagadahoc (Nedeau et al., 2000). In Massachusetts, it is relatively common in small to medium sized streams of the Connecticut River drainage but uncommon elsewhere. It also persists in the Merrimack drainage, but is now rare; and in southeastern portions of Massachusetts (Smith, 2000). Three newly discovered individuals were discovered in the Delaware River, Pennsylvania (Lellis et al., 2007). In Vermont, it is found in the Winooski River and Lewis Creek systems of the Lake Champlain drainage, and the West River, Passumpsic River, and Nulhegan River systems of the Connecticut River drainage (Fichtel and Smith, 1995). In Connecticut, it is found in many major watersheds (recently absent from Housatonic, south coast drainages, and Thames River drainage- J. Cordeiro, pers. obs., 2006) but is most common in the northern and northwestern parts of the state (Nedeau and Victoria, 2003). In New York, it is widespread along the margins of the Adirondacks, where it has been seen in Oneida Lake, Fish Creek, Black River, Grass River, and Lake Champlain basins; and undiscovered populations may occur throughout eastern New York in some trout streams (Strayer and Jirka, 1997). Erickson (2001) recorded the species at more than 50 sites in north-flowing Adirondack drainage tributary to the St. Lawrence River in New York. In Pennsylvania it only reamains in a few sites in the Delaware River drainage (Spoo, 2008). In Canada, this species is considered secure throughout most of its eastern Canadian range including most of New Brunswick (Hanson and Locke, 2000; Sabine et al., 2004), central, northern, and eastern Nova Scotia (Clark and Rick, 1964), throughout Newfoundland Island, and Prince Edward Island (Davis, 1999) and less common and sensitive to acid rain in Quebec; in Labrador it supposedly occurs throughout the area south from Lake Melville to the Straits of Belle Isle (Metcalfe-Smith and Cudmore-Vokey, 2004). Martel et al. (2004) recorded this species in Lac Philippe, Gatineau Park, southwestern Quebec. Although reported for Saskatchewan in the Carrot River as a highly polished single valve, no other specimens have been found and this specimen likely originated from elsewhere (Metcalfe-Smith and Cudmore-Vokey, 2004). In western Europe, populations are in the Kola peninsula of Russia (Ziuganov et al., 2001), Scandinavia and the British Isles (Young and Williams, 1983), northern (Bauer, 1986) and northwest Spain (Outeiro et al., 2008), and Portugal (Reis, 2003). In central Europe, populations are in the Elbe, danube, Weser, Main/Rhine, and Maas (in Germany, Czech Republic, Austria, Belgium, Luxenbourg) with small populations in France (Massiv Central, Arquitaine, Brittany) and Baltic states; and "functional" populations in Germany (Lutter), Czech Republic (Blanice), Portugal (Douro tribs.), Scotland (several), Ireland (western), northern Scandinavia (Pikku-Luiro), and Russia (Varzuga) (see Geist, 2010).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Remaining populations in most of Europe are characterised by an ageing cohort of individuals with little or no recent recruitment (Beasley and Roberts, 1996; 1999; Beasley et al., 1998). The largest population known, on the Varzuga River in Northern Russia, is estimated at approximately 51 million over a 200 km stretch of river (Ziuganov et. al. 1998). Some northeastern Canadian populations have numbers in the thousands (Metcalfe-Smith and Cudmore-Vokey, 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

It is thought to be the longest-lived invertebrate animal. Its average life span in Europe is 93 years old and a specimen in Russia was determined to be at least 114 years old (Ziuganov et. al. 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Life span ranges from 30-167 years and maximum size from 30-162 mm (Hastie et al., 2000). Ages of M. margaritifera determined from growth lines sometimes exceed 100 years in Europe (Bauer, 1992; Hendelberg, 1960).Populations in the southern parts of the range typically reach a smaller maximum size in a shorter period and reproduce at a younger age than northern populations (Bauer, 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

The zygote that forms when sperm and egg meet inside of the female (or hermaphrodite) mussel is called a glochidium (plural glochidia). Glochidia spend several weeks developing inside of the mussel, eventually growing 0.6 to 0.7 mm in size and resembling tiny mussels with their shells held open. The glochidia are then released into the open water, where they float with the current. The next stage of development occurs on a fish host. If a glochidium makes physical contact with a fish's gills, it will clamp onto the gills and begin developing into a juvenile freshwater pearl mussel. The presence of glochidia in the gills of a fish has no observable negative effects on the host, but helps the glochidia disperse over a wider range than could be possible by freely floating in a stream. Host attachments typically occur within several hours of glochidia release. Most glochidia never find a host and die after six days of floating in the current.

Many different fish can act as hosts to glochidia. In Europe, these fish include huchen (Hucho hucho), Atlantic salmon (Salmo salar), brown trout (Salmo trutta), and Eurasian dace (Phoxinus phoxinus). Hosts in the United States are primarily salmon and trout species, including coho salmon (Oncorynchus kisutch), rainbow trout (Oncorhynchus mykiss), cuttthroat trout (Oncorhynchus clarkii clarkii), chinook salmon (Oncorhynchus tshawytscha), and sockeye salmon (Oncorhynchus nerka). Brook trout (Salvelinus fontinalis) can also serve as hosts.

After eight to nine months developing in a fish's gills, the glochidia detach themselves. This is when young freshwater pearl mussels are the most vulnerable, as there are many factors that could result in death. Should glochidia land in clean gravel or sand substrate, they will likely survive and start to grow. But if glochidia land in unfavorable substrates, such as mud or silt, they die. Glochidia are also likely to perish if they have not developed to a sufficient size in the host fish. High levels of ammonia, nitrate, phosphate, sodium, potassium, calcium, and magnesium - all of which are chemicals commonly introduced to rivers by humans - also have a negative impact on glochidia survival. For reasons not fully understood, juvenile mussels growing in locations with sizable aquatic insect (Chironomidae) populations are more likely to survive. If the juvenile mussel survives, its development will be slower than an adult's - about one to two millimeters per year. It will take about twenty years for the juvenile mussel to become an adult, at which time it will continually grow about three millimeters per year until its death.

Development - Life Cycle: colonial growth ; indeterminate growth

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Freshwater pearl mussels are a long-lived species. The average lifespan ranges from 86 to 102 years, although lifespan varies greatly with environmental factors such as water quality. The oldest freshwater pearl mussel was found to be 280 years old. However, few freshwater pearl mussels survive their first year; most are either washed away by the current as glochidia or die due to unsuitable living conditions as juveniles.

Range lifespan

Status: wild:
280 (high) years.

Average lifespan

Status: wild:
93 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

This species has a very high fecundity (upward of 17 million glochidia produced annually) (Bauer, 1987) and the smallest glochidia. Mean age of sexual maturity is 20 years and individuals are known to live over 100 years (Bauer, 1987) and even the oldest individuals show no reduction in fecundity in regard to production of glochidia (Young and Williams, 1983; Hastie and Young, 2003). The host fish in central Europe are the huchen (Hucho hucho), brown trout (Salmo trutta), Eurasian dace (Phoxinus phoxinus phoxinus), and Atlantic salmon (Salmo salar) (Bauer, 1987; Harms, 1907). Additional hosts in the United States include the cutthroat trout (Oncorhynchus clarki), coho salmon (Oncorynchus kisutch), rainbow trout (Oncorhynchus mykiss), sockeye salmon (Oncorhynchus nerka), chinook salmon (Oncorhynchus tshawytscha), brook trout (Salvelinus fontinalis) (Bauer, 1987; Karna and Millemann, 1978; Meyers and Millemann, 1977; Wells et. al., 1983; Young et al., 1987; Young and Williams, 1984). Young and Williams (1984), however claim rainbow trout is unsuitable. Only sea trout, brown trout, and Atlantic salmon are known to host complete metamorphosis in Europe with brown trout the main host species in Ireland and Germany and brook charr acting as host in north America (Skinner et al., 2003). Also brook trout is an unsuitable host in Europe despite being an important host in North America (Ziuganov et al., 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater pearl mussels are dioecious, meaning that females and males exist in the species. Both sexes can also change into hermaphrodites, although males rarely do. Hermaphrodites frequently can be found in low-density populations, where there are not enough males to fertilize all of the females.

Mating System: polygynandrous (promiscuous)

In early summer months, cued by rising temperatures, males release sperm into the water column, where it is ingested by females carrying eggs. There is a drawback to this system; since sperm is swept away by the current, not all females may become fertilized in a freshwater pearl mussel colony. In addition, populations with low numbers of males may not be able to produce enough sperm to fertilize most of the females. Because of this, mussels can undergo asexual reproduction and self-fertilize as hermaphrodites. For example, females who are positioned far upstream of males will not become fertilized, and thus may become temporary hermaphrodites. Since hermaphrodites form due to the inability of a male to fertilize a female, it is very unlikely for any males to become hermaphrodites.

Sexual maturity varies with growth rate of the mussel, but is typically reached in twenty years. The faster the mussel can develop, the sooner it will become sexually mature. Once they are sexually mature, freshwater pearl mussels release sperm or produce eggs every year until they die, although only two out of every three females in a typical population will be fertile each year.

Interestingly, fecundity does not appear to be affected by pollution, population density of mussels, or water discharge, although those factors will certainly affect the survival of the offspring.

Breeding interval: Sexually mature freshwater pearl mussels breed once every year until their death.

Breeding season: Breeding occurs from June to July.

Range number of offspring: 1 to 4000000.

Range gestation period: 1 to 3 months.

Range age at sexual or reproductive maturity (female): 10 to 20 years.

Average age at sexual or reproductive maturity (female): 20 years.

Range age at sexual or reproductive maturity (male): 10 to 20 years.

Average age at sexual or reproductive maturity (male): 20 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); simultaneous hermaphrodite; sexual ; asexual ; fertilization (Internal ); broadcast (group) spawning; oviparous

Fertilized eggs spend roughly four weeks developing inside the female mussel before they are released to the open water.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Margaritifera margaritifera

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 36 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTGCGGTGGTTTTTTTCTACTAATCATAAAGATATTGGGACCTTGTATATAGTGTCGGCTTTATGATGAGGGTTGGTTGGCTTATCTTTGAGCTTAATTATTCGGGTTGAGTTGGGCCAACCCGGTATGTTTTTGGGAAGG---GATCAGTTATACAATTCGATTGTCACTTCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCAACTATAATAGGGGGGTTTGGGAATTGGCTTGTCCCCCTTATGTTAGGGTGTCCCGATATGGCTTTTCCTCGGTTGAATAATATGAGGTTTTGGTTGTTAATGTGCTCTGGGGTTTTGATGGTGTGGTCTATGTTTGTGGAAGGTGGTTGTGGGACTGGGTGAACTATGTATCCGCCGTTGTCTAACAGGGTTTTTCATTCAGGTGTTTCTGTTGACATTTTGATTTTTTCTCTTCATTTGGCTGGGGTTTCTTCTATTATCGGTGCTTTGAACTTTATCAGTACAATTAGGAATATGCGGGTTTCCCCGATATTGATAGAGTGTTTGCCGTTATTCGCTTGGAGCGTATTGGTGACGGCTGGCTTAATTCTGTTATCTTTTCCGGTGTTAGCGGCGGCAATCACGATACTTTTGACGGATCGCAATTTTAACACGTCTTTCTTTGTACCTATGGGTGGGGGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Margaritifera margaritifera

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 36
Specimens with Barcodes: 41
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: This species has a very large distribution with some very large healthy populations remaining in North America and some parts of Europe; has suffered significant widespread declines in occupancy, range extent, and number of occurrence across its entire range in Europe, however, including several national extirpations, with less serious declines in the U.S. and Canada.

Intrinsic Vulnerability: Moderately vulnerable

Comments: Because this species is extremely long-lived (over 100 years) and reaches sexual maturity at about 20 years (Bauer, 1987), populations can effectively be functionally extinct if they are either not reproducing or host fish are not present; although this might not be evident unless extremely long-term monitoring was in place. In many cases, the greatest concern is lack of juvenile reproduction in European populations over the past 30-50 years leading to fragmentation and isolation of otherwise healthy populations.

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Comments: Typically, this species is intolerant of eutrophication and prefers flowing water in softwater streams with low calcium levels (Bauer, 1988; Buddensiek, 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1ce+2c

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Mollusc Specialist Group

Reviewer/s

Contributor/s

History
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Freshwater pearl mussels are listed as an endangered species and conservation efforts have primarily been directed towards increasing juvenile populations. Many populations consist of only adults because environmental conditions are too harsh for juveniles. Eutrophication, where chemicals added into the river cause algal blooms, are particularly devastating as they interfere with the freshwater pearl mussel's ability to obtain food, reproduce, and obtain oxygen from the water.

An attempt to conserve freshwater pearl mussels must include an effort to restore populations of host fish. In some mussel populations, a lack of host fish for glochidia to attach to has led to decreased numbers of juveniles. Causes for the lack of host fishes vary depending on the needs of the fish species; common reasons include acidification of lakes and streams and the introduction of invasive host species that out-compete native populations.

Humans have also impacted populations of freshwater pearl mussels. Over-harvesting of mussels for pearls has diminished many populations. This practice has been outlawed in an effort to protect surviving populations, but it continues illegally today.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List. Subspecies: Margaritifera margaritifera durrovensis is classified as Critically Endangered (CR) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 30-70%

Comments: Historically, the species was extremely common in suitable rivers throughout most of its range in Europe but its range and abundance is now much reduced. Analysis of British records show that there has been a dramatic and sustained decline in the species, which was especially marked in England and Wales (Cosgrove et al., 2000). A recent survey found that M. margaritifera were extinct in approximately two thirds of the Scottish rivers in which they were original found (Cosgrove et al., 2000). Information on the current distribution of M. margaritifera in Ireland suggests that the species has undergone a large decline in both absolute numbers and range (Cosgrove et al., 2000). Of particular concern is the virtual extinction of the hard-water form Margaritifera margaritifera durrovensis (Costello et al., 1998). The species has suffered significant declines in the late 1900's in North and Central Europe (Wells et. al., 1983), but is doing well in other parts of range. Raithel and Hartenstein (2006) documented declines in Rhode Island populations including some Pawcatuck River basin populations and complete extirpation from the Pawtuxet and Blackstone River basins in the 1990s. In Maine, although the species is widely distributed, it is not often abundant, frequently with only a few old individuals and little evidence of recruitment (Nedeau et al., 2000).

Global Long Term Trend: Decline of 50-70%

Comments: The species has suffered significant declines in the late 1900's in North and Central Europe (Wells et. al., 1983), but is doing better in other parts of range. Bauer (1986; 1988) estimates a 95-100% decline in known populations in central and southern Europe by the 1990s. Declines have also occurred in North America but not nearly to the vast extent that they have in Europe (Young et al., 2001; Araujo and Ramos, 2001). The current status across its range is as follows: USA- declining and of special concern but somewhat stable in New England, Canada- some large populations remain and threats are few, Portugal- presumed extinct, Spain- serious decline with one or two functional populations, France- still present but scarce in most of its former range, Belgium- extirpated, Germany- still present but serious decline although some functional populations in Bavaria, Austria- serious decline with 1-2 functional populations, Czech Republic- serious decline with one functional population, Norway- serious decline especially in the south, Denmark- extirpated, Sweden- serious decline with appreciable recruitment at only two sites, Finland- 75% populations lost with ca 8 functional populations, Russia- serious decline with four populations of over 1 million remaining, Eire- serious decline with little recruitment, England- only one common population remaining with limited recruitment, Wales- only one population above 3000 individuals and very few juveniles, Northern Ireland- 90% population lost and almost no recruitment, Scotland- serious decline with ca 10 fully functional populations (Young et al., 2001). Ortmann (1919) cites Pennsylvania occurrences in the Schuykill basin and now it occurs there in a single site. It once likely occurred in the Hackensack River in Rockland County, New York, into neighboring New Jersey but it is likely gone due to intensive residential development (summarized in Strayer and Jirka, 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Potential threats include overcollecting for the pearl industry and alteration of habitat. Declines in Europe are attributed to increasing pollution and habitat alteration, drainage of wetlands, building of dams, and canalization of rivers. Although predation may be a minor threat to populations in North America, there is no direct evidence to suggest that natural predation causes any significant mortality in rivers in Scotland (despite minor, opportunistic predation by otter, mink, oystercatcher and hooded crow) (Cosgrove et al., 2007). Hastie et al. (2003) outline how climate change might potentially negatively affect populations in northern Europe such as through flooding, temperature change, habitat loss, sea level rise, host fish stock changes, etc. Failure to recruit - a figure of at least 20% of the population between 10 - 20 years old in much of Europe is often used as an estimate of what constitutes a viable mussel population (Young et al., 2000; Young et al., 2001). In addition, there is recent evidence to suggest that illegal and destructive pearl fishing has been occurring at practically every British and Irish river (Young et al., 2000). There are numerous examples of the detrimental effects of pollution on M. margaritifera (Ziuganov et al., 1994). One of the factors implicated in the decline of M. margaritifera in the UK has been the destruction of suitable river habitat through modification of river beds for drainage and flow regulation schemes and fisheries management (Cosgrove et al., 2000; Young et al., 2000). Long-term survival clearly depends on availability of host species (Hastie and Cosgrove, 2001). Pearl mussel populations may be vulnerable to climate change through increases in temperatures (it is a cold water species) and through changes in rainfall resulting in a sequence of higher water levels and flooding followed by low water levels and channel bed exposure; although this is speculative.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Once the most abundant bivalve mollusc in ancient rivers around the world, numbers of the freshwater pearl mussel are now declining in all countries and this species is nearly extinct in many areas (4). The causes of this decline are not fully understood, but alteration and degradation of its freshwater habitat undoubtedly plays a central role (4). The negative impacts humans have on rivers and streams come from a wide range of activities, including, but not restricted to, river regulation, drainage, sewage disposal, dredging, and water pollution (4). Anything that affects the abundance of the fish hosts will also affect the freshwater pearl mussel; for example, the introduction of exotic fish species, such as the rainbow trout, reduces the number of native fish hosts (4). Introduced species are also directly affecting the freshwater pearl mussel; the invasion of the zebra mussel (Dreissena polymorpha), which has been spread to new locations by being transported on the bottom of boats or in ballast waters, has impacted freshwater pearl mussel populations in all countries it has invaded (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: In mainland Britain, pearl fishing is now illegal and it is an offence to harm M. margaritifera or its habitat. The species is now fully protected in Great Britain under the terms of the Wildlife and Countryside Act (1981). The species has been identified by the UK Government in its Biodiversity Action Plan (BAP) as a priority for conservation action (UK Biodiversity Steering Group, 1995). The species has been the subject of a European action plan (Araujo and Ramos, 2001). There are some culture and propagation efforts underway in Europe (i.e. northern Ireland).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The freshwater pearl mussel, which is completely protected in most European countries (9), has been the focus of a significant amount of conservation efforts (8). Measures have included the transfer of adult mussels to areas where it had gone extinct (8) (10), the culture of juvenile mussels, and the release of juvenile trout, which have been infected with glochidia, into small rivers (10). The freshwater pearl mussel has also benefited from habitat restoration projects in some areas (10). Due to the essential role salmonid fish play in the life of the freshwater pearl mussel, the conservation of salmon and trout is also central in the survival of this endangered freshwater mussel (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no adverse effects of freshwater pearl mussels on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

As the name might suggest, freshwater pearl mussels were commercially important in the pearl industry before they achieved endangered status. Illegal harvest of pearls from populations of freshwater pearl mussels continue today, making it necessary for wildlife agencies to keep secret the exact locations of freshwater pearl mussel populations.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Conservation management strategies have been outlined by Geist (2010) at the individual/population (assessment of inbreeding coefficiends and population uniqueness, gene flow, avoidance of genetic effects in captive breeding, mapping of distribution, assessment of life hsitory and edmography, assessment of local impacts, identification of stakehoulders, assessment of effects of local management), species (development of genetic markers, non-destructive sampling techniques, definition of Conservation Units, recommendation of conservation strategies supporting breeding and culturing techniques, assessment of life-stage specific importance of decline factors, standardizatino of field sampling protocols, ecological conservation prioritization, food requirements of juveniles), and global (testing links between genetic diversity with co-occurring species, mergint genetic and ecological data, dexidions on biodvierstiy hotspots, testing effects of introduction/extinction on ecosystem function, decisions on protected areas) levels.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Freshwater pearl mussel

The freshwater pearl mussel, scientific name Margaritifera margaritifera, is an endangered species of freshwater mussel, an aquatic bivalve mollusc in the family Margaritiferidae.

Although the name "freshwater pearl mussel" is often used for this species, other freshwater mussel species can also create pearls and some can also be used as a source of mother of pearl. In fact, most cultured pearls today come from Hyriopsis species in Asia, or Amblema species in North America, both members of the related family Unionidae; pearls are also found within species in the genus Unio.

The interior of the shell of Margaritifera margaritifera has thick nacre (the inner mother of pearl layer of the shell). This species is capable of making fine-quality pearls, and was historically exploited in the search for pearls from wild sources. In recent times, the Russian malacologist Valeriy Zyuganov received worldwide reputation after he discovered that the pearl mussel exhibited negligible senescence and he determined that it had a maximum lifespan of 210–250 years.[2][3] The data of V.V. Zyuganov have been confirmed by the Finnish malacologists[4] and gained general acceptance.

Subspecies[edit]

Subspecies within the species Margaritifera magaritifera include:

Physical description[edit]

The anatomy of Margaritifera margaritifera
1. Posterior adductor muscle
2.
Anterior adductor muscle
3. Frontal gill
4. Back gill
5. Exhalant aperture
6. Inhalant aperture
7. Foot
8. Pseudotooth
9. The hingeline and ligament
10. Mantle
11. The shell's thickest part, the umbo

The freshwater pearl mussel is one of the longest-living invertebrates in existence.[6] The oldest known specimen in Europe was caught in 1993 in Estonia when it was 134 years old.[7]

Like all bivalve molluscs, the freshwater pearl mussel has a shell consisting of two parts that are hinged together, which can be closed to protect the animal’s soft body within.[8] The shell is large, heavy and elongated,[9][10] typically yellowish-brown in colour when young and becoming darker with age.[6] Older parts of the shell often appear corroded, an identifying feature of this mussel species.[11] The inner surface of the shell is pearl white, sometimes tinged with attractive iridescent colours.[9] Like all molluscs, the freshwater pearl mussel has a muscular 'foot';[8] this very large, white foot enables the mussel to move slowly and bury itself within the bottom substrate of its freshwater habitat.[9][10]

Distribution[edit]

Group of live Margaritifera margaritifera in a river bed in Sweden

The native distribution of this species is Holarctic. The freshwater pearl mussel can be found on both sides of the Atlantic,[9] from the Arctic and temperate regions of western Russia, through Europe to northeastern North America.[6]

  • North America: eastern Canada and New England in the United States' Northeast[12][13]
  • Europe, including:
    • Austria - estimated total population of 70 000 individuals in Mühlviertel (declining) and in Waldviertel (some recruitment), in the states of Upper and Lower Austria, respectively.[14]
    • Belgium
    • Czech Republic - critically endangered (CR).[15][16] In Bohemia, probably locally extinct in Moravia.[17] Listed in Decree for implementation, No. 395/1992 Sb. (Czech code) (in Czech: Vyhláška 395/1992 Sb. ve znění vyhl. 175/2006 Sb.) as Critically Threatened species. Its Conservation status in 2004-2006 is bad (U2) in report for European commission in accordance with Habitats Directive.[18]
    • Denmark
    • Estonia
    • Fennoscandia - vulnerable in Finland and Norway, endangered in Sweden.[19][20][21] Very rare in southern Finland, more common in the north. Widespread but not common in Norway; Norway is considered to host a large proportion of the European stock. Rare in Sweden.[22] Also in Kola Peninsula and Karelia (Russia) (see below).
    • France[23]
    • Germany - critically endangered (vom Aussterben bedroht).[24] Listed as strictly protected species in annex 1 in Bundesartenschutzverordnung.
    • Great Britain. More than half the world's recruiting population exists in Scotland with populations in more than 50 rivers, mainly in the Highlands, although illegal harvesting has seriously affected their survival. 75% of sites surveyed in 2010 had suffered "significant and lasting criminal damage" and in response the police and Scottish Natural Heritage have launched a campaign to protect the species.[25][26] This species has been fully protected in the United Kingdom under the Wildlife and Countryside Act 1981 since 1998 and partly protected according to section 9(1) since 1991.[27]
    • Iberian Peninsula (Portugal and Spain)
    • Ireland. The Cladagh (Swanlinbar) river contains one of the largest populations surviving in northern Ireland, estimated minimum 10,000, confined to a 6 km stretch of undisturbed river in the middle section.[28]
    • Luxembourg
    • Latvia
    • Lithuania - extinct
    • Poland - extinct[29][30]
    • Russian Federation - in the rivers of the White Sea basin of the Arkhangelsk and Murmansk Regions. It is east border of the area of distribution M. margaritifera.

Habitat[edit]

Clean, fast-flowing streams and rivers are required for the freshwater pearl mussel,[6][9] where it lives buried or partly buried in fine gravel and coarse sand,[6] generally in water at depths between 0.5 and 2 metres, but sometimes at greater depths.[9] Clean gravel and sand is essential, particularly for juvenile freshwater pearl mussels, for if the stream or river bottom becomes clogged with silt, they cannot obtain oxygen and will die.[9] Also essential is the presence of a healthy population of salmonids, a group of fish including salmon and trout, on which the freshwater pearl mussel relies for part of its life cycle.[9]

Lifecycle[edit]

life cycle

Capable of living for up to 130 years,[31] the freshwater pearl mussel begins life as a tiny larva, measuring just 0.6 to 0.7 millimetres long, which is ejected into the water from an adult mussel in a mass of one to four million other larvae. This remarkable event takes place over just one to two days, sometime between July and September.[6] The larvae, known as glochidia, resemble tiny mussels, but their minute shells are held open until they snap shut on a suitable host. The host of freshwater pearl mussel larvae are juvenile fish from the salmonid family, which includes the Atlantic salmon and sea trout.[6] The chances of a larva encountering a suitable fish is very low,[11] and thus nearly all are swept away and die; only a few are inhaled by an Atlantic salmon or sea trout, where they snap shut onto the fish’s gills.[6]

Attached to the gills of a fish, the glochidia live and grow in this oxygen-rich environment until the following May or June, when they drop off. The juvenile must land on clean gravely or sandy substrates if it is to successfully grow.[6] Attached to the substrate, juvenile freshwater pearl mussels typically burrow themselves completely into the sand or gravel, while adults are generally found with a third of their shell exposed.[6] Should they become dislodged, freshwater pearl mussels can rebury themselves, and are also capable of moving slowly across sandy sediments, using their large, muscular foot.[6]

The freshwater pearl mussel grows extremely slowly,[11] inhaling water through exposed siphons, and filtering out tiny organic particles on which it feeds.[6] It is thought that in areas where this species was once abundant, this filter feeding acted to clarify the water, benefiting other species which inhabited the rivers and streams.[6] Maturity is reached at an age of 10 to 15 years,[6] followed by a reproductive period of over 75 years in which about 200 million larvae can be produced.[11] In early summer each year, around June and July, male freshwater pearl mussels release sperm into the water, where they are inhaled by female mussels. Inside the female, the fertilised eggs develop in a pouch on the gills for several weeks, until temperature or other environmental cue triggers the female to release the larvae into the surrounding water.[6]

The interior of the shell of Margaritifera margaritifera, showing the nacre

Threats and conservation[edit]

Once the most abundant bivalve mollusc in ancient rivers around the world, numbers of the freshwater pearl mussel are now declining in all countries and this species is nearly extinct in many areas.[9] The causes of this decline are not fully understood, but alteration and degradation of its freshwater habitat undoubtedly plays a central role.[9] The negative impacts humans have on rivers and streams come from a wide range of activities such as river regulation, drainage, sewage disposal, dredging, and water pollution, including the introduction of excess nutrients.[9] Anything that affects the abundance of the fish hosts will also affect the freshwater pearl mussel; for example, the introduction of exotic fish species, such as the rainbow trout, reduces the number of native fish hosts.[9] Introduced species are also directly affecting the freshwater pearl mussel; the invasion of the zebra mussel (Dreissena polymorpha), which has been spread to new locations by being transported on the bottom of boats or in ballast waters, has impacted freshwater pearl mussel populations in all countries it has invaded.[9]

The freshwater pearl mussel, which is completely protected in most European countries,[32] has been the focus of a significant amount of conservation efforts.[33] Measures have included the transfer of adult mussels to areas where it had gone extinct,[33][34] the culture of juvenile mussels, and the release of juvenile trout, which have been infected with glochidia, into small rivers, but mainly the freshwater pearl mussel has benefited from habitat restoration projects in some areas.[34] Due to the essential role salmonid fish play in the life of the freshwater pearl mussel, the conservation of salmon and trout is also central in the survival of this endangered freshwater mussel.[9]

References[edit]

This article incorporates text from the ARKive fact-file "Freshwater pearl mussel" under the Creative Commons Attribution-ShareAlike 3.0 Unported License and the GFDL.

  1. ^ Mollusc Specialist Group (1996). Margaritifera margaritifera. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 13 Jan 2007.
  2. ^ Ziuganov, V., San Miguel, E., Neves, R.J., Longa, A., Fernandez, C., Amaro, R., Beletsky, V., Popkovitch, E., Kaliuzhin, S., Johnson, T. (2000). "Life span variation of the freshwater pearlshell: a model species for testing longevity mechanisms in animals.". Ambio ХХIX (2): 102–105. doi:10.1579/0044-7447-29.2.102. 
  3. ^ Зюганов В.В. (2004). "Арктические долгоживущие и южные короткоживущие моллюски жемчужницы как модель для изучения основ долголетия.". Успехи геронтол. 14: 21–31. 
  4. ^ Helama S., Valovirta I. (2008). "The oldest recorded animal in Finland: ontogenetic age and growth in Margaritifera margaritifera (L. 1758) based on internal shell increments.". Memoranda Soc. Fauna Flora Fennica 84: 20–30. 
  5. ^ 2007 IUCN Red List – Search
  6. ^ a b c d e f g h i j k l m n o Skinner, A., Young, M. and Hastie, L. (2003) Ecology of the Freshwater Pearl Mussel. Conserving Natura 2000 Rivers. Ecology Series No. 2. English Nature, Peterborough.
  7. ^ Ulvar Käärt. "Kas teadsid, et Eesti loomariigi vanuserekord sai 20-aastaseks." Eesti Päevaleht 16. veebruar 2013. (Estonian)
  8. ^ a b Burnie, D. (2001) Animal. Dorling Kindersley, London.
  9. ^ a b c d e f g h i j k l m n Araujo, R. and Ramos, M.A. (2000) Action Plan for Margaritifera margaritifera in Europe. Council of Europe, Strasbourg.
  10. ^ a b Moorkens, E.A. (1999) Conservation Management of the Freshwater Pearl Mussel Margaritifera margaritifera. Part 1: Biology of the Species and its Present Situation in Ireland. Irish Wildlife Manuals, No. 8. Dúchas, The Heritage Service, Dublin.
  11. ^ a b c d Lampert, W. and Sommer, U. (1996) Limnoecology: The Ecology of Lakes and Streams. Oxford University Press, Oxford.
  12. ^ Smith, Douglas G. (July 1976). "Notes on the Biology of Margaritifera margaritifera margaritifera (Lin.) in Central Massachusetts". American Midland Naturalist (The University of Notre Dame) 96 (1): 252–256. doi:10.2307/2424588. Retrieved 8 May 2012. 
  13. ^ Bauer, G. (June 1987). "Reproductive Strategy of the Freshwater Pearl Mussel Margaritifera margaritifera". Journal of Animal Ecology (British Ecological Society) 56 (2): 691–704. doi:10.2307/5077. Retrieved 8 May 2012. 
  14. ^ Gumpinger, Clemens; Wolfgang Heinisch; Johannes Moser; Thomas Ofenböck; Claus Stundner (2002). Die Flussperlmuschel in Österreich. Wien: Umweltbundesamt. ISBN 3-85457-644-7. 
  15. ^ Juřičková L., Horsák M. & Beran L., 2001: Check-list of the molluscs (Mollusca) of the Czech Republic. Acta Soc. Zool. Bohem., 65: 25-40.
  16. ^ Red List of the molluscs (Mollusca) of the Czech Republic http://mollusca.sav.sk/malacology/redlist.htm
  17. ^ (Czech) Horsák M., Juřičková L., Beran L., Čejka T. & Dvořák L. (2010). "Komentovaný seznam měkkýšů zjištěných ve volné přírodě České a Slovenské republiky. [Annotated list of mollusc species recorded outdoors in the Czech and Slovak Republics]". Malacologica Bohemoslovaca, Suppl. 1: 1-37. PDF.
  18. ^ Dušek J., Hošek M. & Kolářová J. (2007) Hodnotící zpráva o stavu z hlediska ochrany evropsky významných druhů a typů přírodních stanovišť v České republice za rok 2004-2006. - Ochrana přírody, 62(5): appendix 5:I-IV. (in Czech language)
  19. ^ "Threatened and Near Threatened molluscs". 2001. 
  20. ^ "Artsdatabanken". 2010. 
  21. ^ "ArtDatabanken". 2010. 
  22. ^ [1] cited 16 February 2007
  23. ^ "Recherche de sites par espèce: Invertébrés: Moule perlière (Margaritifera margaritifera)". 2007. 
  24. ^ Glöer P. & Meier-Brook C. (2003) Süsswassermollusken. DJN, pp. 134, page 109, ISBN 3-923376-02-2
  25. ^ "Invertebrate species: molluscs". Joint Nature Conservation Committee. Retrieved 13 January 2007. 
  26. ^ "Police crack down on illegal 'ransacking' of mussel sites". Glasgow: The Herald. 26 May 2010. 
  27. ^ Protection for wild animals on Schedule 5 of the Wildlife and Countryside Act, 1981. website accessed 7 August 2009.
  28. ^ "Cladagh (Swanlinbar) River" Joint Nature Conservation Committee. Retrieved 31 May 2010.
  29. ^ Margaritifera margaritifera - Polska Czerwona Księga Zwierząt - Bezkręgowce
  30. ^ pl:Polska Czerwona Księga Zwierząt - Bezkręgowce
  31. ^ Sturm, C.F., Pearce, T.A. and Valdés, A. (2006) The Mollusks: A Guide to Their Study, Collection, and Preservation. Universal-Publishers, Boca Raton, Florida.
  32. ^ Young, M.R. (1991) Conserving the freshwater pearl mussel (Margaritifera margaritifera L.) in the British Isles and Continental Europe. Aquatic Conservation: Marine and Freshwater Ecosystems, 1(1): 73 - 77.
  33. ^ a b Scottish Natural Heritage (October 2008).
  34. ^ a b Hastie, L.C. and Young, M.R. (2003) Conservation of the Freshwater Pearl Mussel I. Captive Breeding Techniques. Conserving Natura 2000 Rivers Conservation Techniques Series No. 2. English Nature, Peterborough.

Further reading[edit]

  • Anonymous 2004. Margaritifera margaritifera. Stage 1 and Stage 2 survey guidelines. Irish Wildlife Manuals, No. 12. National Parks and Wildlife Service, Department of Environment, Heritage and Local Government, Dublin, Ireland. 25 pp.
  • Moorkens E. A. 2000. Conservation Management of the Freshwater Pearl Mussel Margaritifera margaritifera. Part 2: Water Quality Requirements. Irish Wildlife Manuals, No. 9., 44 pp.
  • Makhrov A., Bespalaya J., Bolotov I., Vikhrev I., Gofarov M., Alekseeva Ya., Zotin A. 2013. Historical geography of pearl harvesting and current status of populations of the freshwater pearl mussel Margaritifera margaritifera (L.) in west part of Northern European Russia. – Hydrobiologia. DOI 10.1007/s10750-013-1546-1
  • Bolotov, I.N., Yu.V. Bespalaya, A.A. Makhrov, P.E. Aspholm, A.S. Aksenov, M.Yu. Gofarov, G.A. Dvoryankin, O.V. Usacheva, I.V. Vikhrev, S.E. Sokolova, A.A. Pashinin & A.N. Davydov, 2012. Influence of Historical Exploitation and Recovery of Biological Resources on Contemporary Status of Margaritifera margaritifera L. and Salmo salar L. Populations in Northwestern Russia. - Biology Bulletin Reviews 2(6): 460–478. DOI 10.1134/S2079086412060035
  • Bespalaya Yu.V., Bolotov I.N., Makhrov A.A., Vikhrev I.V. 2012. Historical Geography of Pearl Fishing in Rivers of the Southern White Sea Region (Arkhangelsk Oblast). - Regional Research of Russia 2(2): 172–181. DOI 10.1134/S2079970512020025
  • Bespalaja Yu.V., Bolotov I.N., Makhrov A.A. 2007. State of the Population of the European Pearl Mussel Margaritifera margaritifera (L.) (Mollusca, Margaritiferidae) at the Northeastern Boundary of Its Range (Solza River, White Sea Basin). - Russ. J. Ecol. 37(3): 222-229. DOI 10.1134/S1067413607030095
  • Bolotov I. N., A. A. Makhrov, Yu. V. Bespalaya, I. V. Vikhrev, O. V. Aksenova, P. E. Aspholm, M. Yu. Gofarov, A. N. Ostrovskii, I. Yu. Popov, I. S. Pal’tser, M. Rudzite, M. Rudzitis, I. S. Voroshilova, S. E. Sokolova 2013. Results of testing the comparatory method: The curvature of the shell valve frontal section is inappropriate as a systematic character for the freshwater pearl mussel of the genus Margaritifera. Biology Bulletin 40(2): 221-231. DOI 10.1134/S1062359013020027
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The family Margaritiferidae is recognized based on the recent work of Smith (1986) and Smith and Wall (1984). The monotypic genus Cumberlandia has generally has been classified in the family Margaritiferidae; however, preliminary analyses of electrophoretic data led Davis and Fuller (1981) to lump the margaritiferids with the Unionidae. Smith and Wall (1984) reinstated the Margaritiferidae to familial rank following and extensive examination and analysis of morphological characters. Some anatomical data on stomach anatomy (Smith, 1986) indicates Cumberlandia may require reduction to subgeneric level. This is supported by Davis and Fuller (1981), Ziuganov et al. (1994), Smith (2001), and Huff et al. (2004). Smith (2001) analyzied the taxonomic placement of the margaritiferid genera, recognizing Pseudunio, Margaritifera, and Margaritinopsis as valid based largely on morpological characters; with Margaritifera margaritifera the only species in the genus Margaritifera. Contrary to Smith (2001), Huff et al. (2004) investigated phylogenetic relationships using sequence data from five molecular markers and concluded recognition of of at least Margaritifera margaritifera, Margaritifera laevis, Margaritifera falcata, and Margaritifera auricularia with the following relationships: Cumberlandia + Margaritifera auricularia; Margaritifera falcata (Margaritifera marrianae + Margaritifera laevis); and to a lesser degree Dahurinaia dahurica + Margaritifera margaritifera. More recently, to monophyletic clades have been identified within Margaritiferidae based on COI data: one including M. margaritifera, M. dahurica, M. falcata, and M. laevis; and a second comprising M. auricularia and M. marocana (Araujo et al., 2009).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!