Ecology
Habitat
Depth range based on 246 specimens in 1 taxon.
Water temperature and chemistry ranges based on 151 samples.
Environmental ranges
Depth range (m): 11 - 262
Temperature range (°C): 17.515 - 25.634
Nitrate (umol/L): 0.289 - 12.388
Salinity (PPS): 35.556 - 36.278
Oxygen (ml/l): 3.530 - 4.855
Phosphate (umol/l): 0.093 - 0.783
Silicate (umol/l): 0.756 - 7.049
Graphical representation
Depth range (m): 11 - 262
Temperature range (°C): 17.515 - 25.634
Nitrate (umol/L): 0.289 - 12.388
Salinity (PPS): 35.556 - 36.278
Oxygen (ml/l): 3.530 - 4.855
Phosphate (umol/l): 0.093 - 0.783
Silicate (umol/l): 0.756 - 7.049
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 151 samples.
Environmental ranges
Depth range (m): 11 - 262
Temperature range (°C): 17.515 - 25.634
Nitrate (umol/L): 0.289 - 12.388
Salinity (PPS): 35.556 - 36.278
Oxygen (ml/l): 3.530 - 4.855
Phosphate (umol/l): 0.093 - 0.783
Silicate (umol/l): 0.756 - 7.049
Graphical representation
Depth range (m): 11 - 262
Temperature range (°C): 17.515 - 25.634
Nitrate (umol/L): 0.289 - 12.388
Salinity (PPS): 35.556 - 36.278
Oxygen (ml/l): 3.530 - 4.855
Phosphate (umol/l): 0.093 - 0.783
Silicate (umol/l): 0.756 - 7.049
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth range based on 116 specimens in 1 taxon.
Water temperature and chemistry ranges based on 60 samples.
Environmental ranges
Depth range (m): 1 - 234
Temperature range (°C): 12.868 - 27.637
Nitrate (umol/L): 0.167 - 18.243
Salinity (PPS): 34.602 - 36.446
Oxygen (ml/l): 3.686 - 5.397
Phosphate (umol/l): 0.019 - 1.156
Silicate (umol/l): 0.756 - 11.020
Graphical representation
Depth range (m): 1 - 234
Temperature range (°C): 12.868 - 27.637
Nitrate (umol/L): 0.167 - 18.243
Salinity (PPS): 34.602 - 36.446
Oxygen (ml/l): 3.686 - 5.397
Phosphate (umol/l): 0.019 - 1.156
Silicate (umol/l): 0.756 - 11.020
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 60 samples.
Environmental ranges
Depth range (m): 1 - 234
Temperature range (°C): 12.868 - 27.637
Nitrate (umol/L): 0.167 - 18.243
Salinity (PPS): 34.602 - 36.446
Oxygen (ml/l): 3.686 - 5.397
Phosphate (umol/l): 0.019 - 1.156
Silicate (umol/l): 0.756 - 11.020
Graphical representation
Depth range (m): 1 - 234
Temperature range (°C): 12.868 - 27.637
Nitrate (umol/L): 0.167 - 18.243
Salinity (PPS): 34.602 - 36.446
Oxygen (ml/l): 3.686 - 5.397
Phosphate (umol/l): 0.019 - 1.156
Silicate (umol/l): 0.756 - 11.020
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Loligo plei
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 24 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 24 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACATTATATTTTATATTTGGTATTTGAGCAGGGTTAGTAGGTACTTCATTGAGGTTAATGATCCGTACAGAACTTGGAAAACCTGGTTCACTTTTAAATGAT---GACCAATTATACAATGTAGTAGTTACTGCCCATGGTTTCATTATAATTTTTTTTATGGTAATACCTATTATAATTGGTGGCTTTGGTAATTGATTAGTACCTATAATGTTAGGTGCTCCAGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGATTACTACCTCCTTCTCTTACCCTTCTCCTAGCCTCTTCGGCTGTTGAAAGTGGTGCCGGAACAGGATGGACAGTATATCCTCCTTTATCCAGTAATCTATCCCACGCTGGTCCCTCTGTAGACCTCGCCATTTTTTCACTCCATTTAGCTGGTATCTCTTCCATTTTGGGAGCAATTAATTTTATCACGACAATCATGAATATACGTTGAGAGGGATTATTGATAGAACGACTTTCTTTATTTGTTTGATCGGTATTCATTACTGCTATTCTTCTTCTTTTATCTCTTCCAGTCCTAGCTGGAGCTATTACAATACTGCTTACTGATCGAAATTTCAATACCACTTTCTTTGACCCAAGAGGTGGTGGGGATCCTATTCTCTACCAACACTTGTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Loligo plei
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 24
Species With Barcodes: 1
Public Records: 24
Specimens with Barcodes: 24
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
