Ecology

Habitat

Depth range based on 246 specimens in 1 taxon.
Water temperature and chemistry ranges based on 151 samples.

Environmental ranges
  Depth range (m): 11 - 262
  Temperature range (°C): 17.515 - 25.634
  Nitrate (umol/L): 0.289 - 12.388
  Salinity (PPS): 35.556 - 36.278
  Oxygen (ml/l): 3.530 - 4.855
  Phosphate (umol/l): 0.093 - 0.783
  Silicate (umol/l): 0.756 - 7.049

Graphical representation

Depth range (m): 11 - 262

Temperature range (°C): 17.515 - 25.634

Nitrate (umol/L): 0.289 - 12.388

Salinity (PPS): 35.556 - 36.278

Oxygen (ml/l): 3.530 - 4.855

Phosphate (umol/l): 0.093 - 0.783

Silicate (umol/l): 0.756 - 7.049
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 116 specimens in 1 taxon.
Water temperature and chemistry ranges based on 60 samples.

Environmental ranges
  Depth range (m): 1 - 234
  Temperature range (°C): 12.868 - 27.637
  Nitrate (umol/L): 0.167 - 18.243
  Salinity (PPS): 34.602 - 36.446
  Oxygen (ml/l): 3.686 - 5.397
  Phosphate (umol/l): 0.019 - 1.156
  Silicate (umol/l): 0.756 - 11.020

Graphical representation

Depth range (m): 1 - 234

Temperature range (°C): 12.868 - 27.637

Nitrate (umol/L): 0.167 - 18.243

Salinity (PPS): 34.602 - 36.446

Oxygen (ml/l): 3.686 - 5.397

Phosphate (umol/l): 0.019 - 1.156

Silicate (umol/l): 0.756 - 11.020
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loligo plei

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 24 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACATTATATTTTATATTTGGTATTTGAGCAGGGTTAGTAGGTACTTCATTGAGGTTAATGATCCGTACAGAACTTGGAAAACCTGGTTCACTTTTAAATGAT---GACCAATTATACAATGTAGTAGTTACTGCCCATGGTTTCATTATAATTTTTTTTATGGTAATACCTATTATAATTGGTGGCTTTGGTAATTGATTAGTACCTATAATGTTAGGTGCTCCAGATATAGCCTTTCCCCGAATAAATAATATAAGATTTTGATTACTACCTCCTTCTCTTACCCTTCTCCTAGCCTCTTCGGCTGTTGAAAGTGGTGCCGGAACAGGATGGACAGTATATCCTCCTTTATCCAGTAATCTATCCCACGCTGGTCCCTCTGTAGACCTCGCCATTTTTTCACTCCATTTAGCTGGTATCTCTTCCATTTTGGGAGCAATTAATTTTATCACGACAATCATGAATATACGTTGAGAGGGATTATTGATAGAACGACTTTCTTTATTTGTTTGATCGGTATTCATTACTGCTATTCTTCTTCTTTTATCTCTTCCAGTCCTAGCTGGAGCTATTACAATACTGCTTACTGATCGAAATTTCAATACCACTTTCTTTGACCCAAGAGGTGGTGGGGATCCTATTCTCTACCAACACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo plei

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 24
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!