Overview

Brief Summary

Introduction

Maximum mantle length 90 cm in males and 41 cm in females. Off the Azores, length at first maturity is 57 cm in males and 34 cm in females. In the English Channel, the size of summer spawning females is 20 cm and 29 cm in winter spawning females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 A long, slender squid up to 90 cm in length with the fins forming an elongate diamond-shape in dorsal view, comprising two-thirds total body length. The tentacle club has median suckers only slightly larger than those on edges. The colour varies but pink, red and brown predominate. The shell has been reduced to a thin, internal horny pen.Also commonly known as the veined squid.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Remarks

The population in the Azores is genetically distinct from those of mainland Europe.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and biology

A species of subtropical and temperate waters (it avoids temperatures below 8.5°C) occurring over the shelf in the temperate part of its distributional range, but found in deeper waters in subtropical areas; the entire depth range extending from about 100 to 400 m.

The population in the northeastern Atlantic is known to carry out seasonal migrations, spending the summer in the North Sea and the eastern part of the English Channel and overwintering in the western part of the Channel. In daytime squids aggregate near the bottom, dispersing at night throughout the water column.

Spawning occurs almost throughout the year in the English Channel, showing a peak in winter (December and January, at temperature of 9 to 11 °C) and another one in summer. The eggs are attached to hard objects on sandy or muddy bottoms; hatching occurs after 30 to 40 days. Juveniles hatched in January and February attain sizes of approximately 11.5 cm in June; by August, the females measure about 14 cm, the males about 15 cm mantle length, and in November about 25 to 30 cm respectively. Both sexes are then mature (the males beginning in October).

Loligo forbesii feeds on small and juvenile fishes, and to a minor extent on other cephalopods, crustaceans, and polychaetes; cannibalism is common. Off the Azores, the most important fish species in their diet is blue jack mackerel (Trachurus picturatus). (Lepidopus caudatus). Other fishes preyed upon include bogue (Boops boops), and silver scabbardfish

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Characteristics

  1. Mantle
    1. Mantle long, moderately slender, cylindrical.
  2. Fins
    1. Fins rhomboidal, their length three quarters that of mantle, their posterior borders slightly concave.
  3. Arms:
    1. Largest arm sucker rings with 7 or 8 teeth.
    2. Left ventral arm hectocotylized in its distal third by modification of suckers into long papillae which gradually decrease in size distally.
  4. Tentacles
    1. Suckers on manus of tentacular club subequal in size; sucker rings with 13 to 18 sharp, conical teeth.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Isles, East Africa, East Atlantic, East North Atlantic, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Mediterranean Sea, Portuguese Exclusive Economic Zone, Red Sea, Somalia, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Loligo forbesii is found on all British and Irish sea coasts, the Mediterranean Sea, the Red Sea, the East African coast, throughout the Atlantic Ocean around many islands, and essentially in all open coast areas. Migration is seasonal among the species and corresponds to the breeding season.

Biogeographic Regions: atlantic ocean (Native )

  • Grzimek, B. 1972. Mollusks. Grzimek's Animal Life Encyclopedia, Vol. 3: Mollusks & Echinoderms. New York, NY: Van Nostrand Reinhold Company.
  • Wilson, E. 1999. "MarLIN: The Marine Life Information Network for Britain & Ireland" (On-line). Accessed September 14, 2001 at http://www.marlin.ac.uk/species/Loligoforbesii.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographical distribution

Eastern Atlantic: 20 °N to 60 °N (excluding the Baltic Sea), Azores Islands, and along west African coast South to the Canary Islands; Mediterranean Sea; southern boundary is unknown. .
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Richard E. Young

Source: Tree of Life web project

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

These cephalopods have eight "normal arms," along with a pair of retractile arms with clubbed suckers on the ends. Their torpedo-shaped, stream-lined bodies with terminal fins often appear somewhat blunter and wider as their depth increases, and enclose a thin membraneous internal shell. The two fins comprise a length of approximately two-thirds of the organism's body and produce a diamond-shape when seen from the dorsal view. These squid have well-developed heads with large eyes that are useful in predation. These squid possess colors and stripes; colors change during the escape mechanisms to a pink, red, or brown hue.

Range length: 12 to 90 cm.

Average length: 40 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

  • Banister, K., A. Campbell. 1985. Mollusks. Pp. 255-270 in The Encyclopedia of Aquatic Life. New York, NY: Facts of File Publications.
  • 1967. Squids, cuttlefishes, octopuses. Pp. 93-94 in The Larousse Encyclopedia of Animal Life. London: McGraw-Hill Book Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Long-finned squid are found in marine habitats, usually near sandy and muddy sea bottoms, but also quite often in clean, coarse sand on the ocean bottom. Loligo forbesii live in waters with a normal oceanic salinity content, usually near-shore regions with warm and rarely cool water, never very cold water.

Range depth: 10 to 500 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13135 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9476 samples.

Environmental ranges
  Depth range (m): -9 - 530
  Temperature range (°C): 6.433 - 17.167
  Nitrate (umol/L): 0.926 - 12.900
  Salinity (PPS): 33.544 - 38.792
  Oxygen (ml/l): 4.403 - 6.467
  Phosphate (umol/l): 0.112 - 0.858
  Silicate (umol/l): 1.843 - 5.963

Graphical representation

Depth range (m): -9 - 530

Temperature range (°C): 6.433 - 17.167

Nitrate (umol/L): 0.926 - 12.900

Salinity (PPS): 33.544 - 38.792

Oxygen (ml/l): 4.403 - 6.467

Phosphate (umol/l): 0.112 - 0.858

Silicate (umol/l): 1.843 - 5.963
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Found over sandy and muddy bottoms.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Loligo forbesii usually feeds on organisms smaller than itself, including herring and other small fish, crustaceans, other cephalopods, and polychaetes, among others. Cannibalism is also common among the species.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Squid are important as a food base for oceanic predators, as well as being important predators of smaller marine vertebrates and invertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Long-finned squids have a muscular bag behind the head which contains the organism's gills that provide rapid jet-propulsion used to escape predators. When the squid retracts backwards by use of the jet-propulsion, the body quickly changes to a much lighter color, and a bag of pigment opens into the mantle cavity that emits a large black cloud, confusing the predator.

Known Predators:

  • Berg, L., D. Martin, E. Solomon. 1999. Biology. Orlando, FL: Harcourt Brace College Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known of communication among Loligo forbesii, yet the most predominate communication and perception channel is visual, using their large, well-developed eyes to recognize sexes for mating, prey for eating, and so forth.

Communication Channels: visual ; tactile

Perception Channels: visual ; tactile

  • Nichols, D., J. Cooke. 1971. The Oxford Book of Invertebrates. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The yolky eggs undergo direct development without the presence of a true larval stage. The eggs are laid in large colorless capsules during the night. The swollen capsules shrink as the embryos develop and, after approximately thirty days of embryonic development, the young hatch, resembling miniature adults, about 5 to 7mm in length. The young maintain a vertical body structure for a period of time, floating and drifting submissively through the water. Growth occurs rapidly for the young during the summer, and the species is sexually mature between the months of June and October. After 1 to 1.5 years, the adults die, completing the life cycle.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The long-finned squid lives approximately 1-2 years in or out of captivity, three years at the most. Natural causes are the common cause of death; adults usually die after a mere year and a half. It is very common for squid to be eaten by predators, explaining why numbers in schools of squid are dramatically reduced during and after migration, falling prey to their predators. Cannibalism is also a very common cause of death of individuals. The large number of eggs produced more than compensates for the high mortality rate. (Wilson 2001, Grzimek 1972)

Range lifespan

Status: wild:
1 to 3 years.

Average lifespan

Status: wild:
1-2 years.

Range lifespan

Status: captivity:
1 to 3 years.

Average lifespan

Status: captivity:
1-1.5 years.

Typical lifespan

Status: wild:
1 to 2 years.

Average lifespan

Status: wild:
1-1.5 years.

Typical lifespan

Status: captivity:
1 to 3 years.

Average lifespan

Status: captivity:
1-2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproductive behavior and specific mating rituals are limited to the act of congregating on the bottom of the sea before fertilization. For reproduction, members of Loligo have fused, unpaired gonads located at the posterior ends of their bodies. Specialized glands of the female provide substances for egg coverings and open into the mantle cavity. This species collects in large numbers on the ocean bottom and produces huge masses of gelatinous spawn. The spawn are attached to solid objects on the ocean bottom.

Male squid gather sperm into a spermatophore carried on a specialized tentacle, called a hectocotylus. This tentacle is used to transfer the spermatophore to the female's mantle cavity, and is possibly broken off there. The anterior portion of the spermatophore has a gelatinous substance that discharges explosively upon contact with the female glandular stucture. The sperm are then released into the mantle cavity to pursue the rather large, yolky eggs.

Mating System: monogamous

Females lay up to 100,000 eggs attached to sea floor substrates. Sexual maturity is reached about one year after hatching. Although it is possible for squid to reproduce more than once, they most often don't because of their limited lifespan.

Breeding interval: Breeding occurs yearly.

Breeding season: Loligo forbesii breed from autumn through spring.

Range number of offspring: 1000 to 100000.

Average number of offspring: 5000-32000.

Range age at sexual or reproductive maturity (female): 11 to 14 months.

Range age at sexual or reproductive maturity (male): 11 to 14 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Females provide their eggs richly with yolk. There is no further parental investment.

Parental Investment: pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female)

  • Banister, K., A. Campbell. 1985. Mollusks. Pp. 255-270 in The Encyclopedia of Aquatic Life. New York, NY: Facts of File Publications.
  • 1967. Squids, cuttlefishes, octopuses. Pp. 93-94 in The Larousse Encyclopedia of Animal Life. London: McGraw-Hill Book Company.
  • Grzimek, B. 1972. Mollusks. Grzimek's Animal Life Encyclopedia, Vol. 3: Mollusks & Echinoderms. New York, NY: Van Nostrand Reinhold Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Loligo forbesi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATTTTCGGTATTTGAGCAGGATTAGTTGGTACTTCATTAAGATTGATAATTCGAACAGAATTAGGAAAACCTGGTTCATTATTAAACGAT---GATCAACTATATAATGTAGTAGTAACTGCTCACGGTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGGAACTGATTAGTGCCCTTAATATTAGGTGCACCCGATATAGCCTTCCCACGTATAAATAATATAAGATTTTGACTACTACCTCCTTCATTAACACTTTTATTAGCTTCATCTGCTGTAGAAAGAGGGGCTGGTACAGGATGAACAGTTTATCCCCCGTTATCTAGAAATCTTTCTCATGCAGGGCCTTCAGTAGATTTAGCCATTTTTTCACTCCATCTTGCTGGGATTTCCTCAATTTTAGGAGCAATTAACTTCATCACAACCATTATAAATATACGATGAGAAGGTTTATTAATAGAACGAATATCCTTATTCGTATGATCTGTATTCATTACAGCAATTTTACTTTTACTATCTCTCCCTGTTTTAGCTGGAGCAATTACAATACTTTTAACTGACCGTAATTTCAATACTACTTTTTTTGATCCAAGAGGGGGAGGAGACCCAATTCTATATCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Loligo forbesi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Loligo forbesii is abundant and is not threatened.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

This species is very common during specific times of the year in nearshore waters and may prey on small fish and herring important to nearshore fisheries. However, squid are also economically important to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Aside from the obvious use of squid as food, research, and education, an unusual use of these squid is for jewelry: many primitive tribes use the hooked rings of the species' suction cups for rings. Loligo forbesii is also used as fish bait and fish-meal production in the Mediterranean.

Positive Impacts: food ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Loligo forbesii

Loligo forbesii, also known as the veined squid or long-finned squid, is a commercially important species of squid in the family Loliginidae.

Contents

Description

Loligo forbesii is a long, slender squid growing up to 90 cm in length with the fins forming an elongate rhomboid in when viewed from above, the fins comprise two-thirds of the total body length. They are variable in colour and pink, red and brown are predominant. The vestigial shell is a thin, internal horny pen.[2]

Distribution

Loligo forbesii can be found around the British Isles, the Mediterranean, and extends through the Red Sea towards the East African coast[3] and Atlantic Ocean south to the Gulf of Guinea. Within the Celtic Sea L. forbesii is one of the two most abundant cephalopods.[4]

Biology

They reside at depths of 10–500 m. Sexual maturity is reached from 11–14 months; the average life span is 1.5 years. The species congregates on the sea floor to mate, with females producing up to 100,000 eggs. Hatchlings are between 5 mm and 7 mm.[5] Their diet is mainly fish, smaller specimens feed mainly on sprats and sandeels but they will prey on other cephalopods[6] and cannibalism is not unknown.[7] The life-cycle of Loligo forbesi is annual, and there is a clear peak of spawning in waters off Scotland from January to March and recruitment of juveniles occurs mainly in the autumn. It is mainly a demersal species.[8] The breeding season of L. forbesi in Galician waters, runs from December through to May, but breeding is most intense from December to February.[9]

Fisheries

Squid are distributed all round the United Kingdom, and are landed in small amounts at most ports. The largest catches are from south west Scotland, the Moray Firth, Rockall and Faroe. The squid catch fluctuates on an annual basis, since with such short lived species the population is very dependent on the success of a single breeding season. The squid fishery tends to be seasonal, coincident with the movement from deep water to inshore grounds. There is no dedicated squid fishery in the UK and most are caught as a bycatch by boats trawling for Whitefish (fisheries term) such as European seabass or Haddock.[10]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!